Экология
<<  Общая экология Основы экологии  >>
Объем экологии (в прямом и переносном смысле слова)
Объем экологии (в прямом и переносном смысле слова)
Идеал количественной науки
Идеал количественной науки
Универсальный инструмент – что это
Универсальный инструмент – что это
Универсальный инструмент – что это
Универсальный инструмент – что это
Пример на тему популяционного анализа: Как оценивают рождаемость
Пример на тему популяционного анализа: Как оценивают рождаемость
Два основных эффекта – top-down и bottom-up
Два основных эффекта – top-down и bottom-up
Два основных эффекта – top-down и bottom-up
Два основных эффекта – top-down и bottom-up
Два основных эффекта – top-down и bottom-up
Два основных эффекта – top-down и bottom-up
Размерно-избирательная элиминация планктонных рачков рыбами
Размерно-избирательная элиминация планктонных рачков рыбами
Размерно-избирательная элиминация планктонных рачков рыбами
Размерно-избирательная элиминация планктонных рачков рыбами
Осталось проверить, приложим ли этот инструмент к природным популяциям
Осталось проверить, приложим ли этот инструмент к природным популяциям
Общая экология
Общая экология
Современное вымирание
Современное вымирание
Какие звери преимущественно вымирают
Какие звери преимущественно вымирают
Общее правило (тенденция): Вымирают преимущественно крупные звери
Общее правило (тенденция): Вымирают преимущественно крупные звери
Кто кого «сборет»: человек пещерного медведя или наоборот
Кто кого «сборет»: человек пещерного медведя или наоборот
Крупные звери размножаются медленнее
Крупные звери размножаются медленнее
Медленно размножающиеся звери не только чаще вымирают, но и чаще
Медленно размножающиеся звери не только чаще вымирают, но и чаще
Зависимость плотности популяции N (число особей/км2) от массы тела W
Зависимость плотности популяции N (число особей/км2) от массы тела W
Геномные – изменение числа хромосом (например, полиплоидизация)
Геномные – изменение числа хромосом (например, полиплоидизация)
Геномные – изменение числа хромосом (например, полиплоидизация)
Геномные – изменение числа хромосом (например, полиплоидизация)
Геномные – изменение числа хромосом (например, полиплоидизация)
Геномные – изменение числа хромосом (например, полиплоидизация)
Геномные – изменение числа хромосом (например, полиплоидизация)
Геномные – изменение числа хромосом (например, полиплоидизация)
Геномные – изменение числа хромосом (например, полиплоидизация)
Геномные – изменение числа хромосом (например, полиплоидизация)
Таблица генетического кода: синонимические и несинонимические замены
Таблица генетического кода: синонимические и несинонимические замены
Кольцевая ДНК митохондрий млекопитающих с указанным на ней цитохромом
Кольцевая ДНК митохондрий млекопитающих с указанным на ней цитохромом
Нуклеотидная последовательность для цитохрома b из GenBank (1140 bp)
Нуклеотидная последовательность для цитохрома b из GenBank (1140 bp)
Kr/Kc polarity
Kr/Kc polarity
Kr/Kc polarity
Kr/Kc polarity
Kr/Kc volume
Kr/Kc volume
Темп накопления мутаций у млекопитающих, относящихся к разным
Темп накопления мутаций у млекопитающих, относящихся к разным
Зависимость вероятности оказаться под угрозой вымирания от темпа
Зависимость вероятности оказаться под угрозой вымирания от темпа
При изменении условий мутация исходно вредная может оказаться полезной
При изменении условий мутация исходно вредная может оказаться полезной
Картинки из презентации «Общая экология» к уроку экологии на тему «Экология»

Автор: Leonard. Чтобы познакомиться с картинкой полного размера, нажмите на её эскиз. Чтобы можно было использовать все картинки для урока экологии, скачайте бесплатно презентацию «Общая экология.ppt» со всеми картинками в zip-архиве размером 3013 КБ.

Общая экология

содержание презентации «Общая экология.ppt»
Сл Текст Сл Текст
1Общая экология. 37(число особей/км2) от массы тела W (г) для
http://ecology.genebee.msu.ru растительноядных млекопитающих lg N =
leonard_polishchuk@hotmail.com. Леонард -0.73 lg W + 4.15 (r = - 0.8, n = 368).
Владимирович Полищук. Кафедра общей Крупные звери вдобавок еще и малочисленны.
экологии Биологического факультета МГУ. Каждая точка -один вид. Источник: Damuth
2Объем экологии (в прямом и переносном J. 1987. Biol. J. Linn. Soc. 31: 193-246,
смысле слова). Вес этой недавно вышедшей Figure 1.
сводки, в которой каждому из выделенных 38Крупные размеры тела, низкая скорость
авторами > 90 разделов экологии уделено размножения и низкая численность,
лишь около 10 страниц, – почти 2 кг! несомненно, скоррелированы с вымиранием
Структура экологии согласно The Princeton (вплоть до того, что по зависимости
Guide to Ecology: аутэкология численности от массы можно количественно
популяционная экология сообщества и предсказать зависимость вероятности
экосистемы ландшафты и биосфера охрана вымирания от массы тела). Однако могут ли
природы (conservation biology) какую они сами по себе быть причиной вымирания?
пользу экосистемы приносят человеку Представляется, что нет, поскольку крупные
(ecosystem services) управление биосферой организмы имеют свойства, компенсирующие,
(biosphere management). The Princeton по крайней мере отчасти, «недостатки»
Guide to Ecology Edited by Simon A. Levin низкой численности: долговечность
Associate editors: Stephen R. Carpenter, взрослых, относительно низкая смертность
H. Charles J. Godfray, Ann P. Kinzig, молоди (результат заботы о потомстве),
Michel Loreau, Jonathan B. Losos, Brian наконец, самое, может быть, главное с
Walker & David S. Wilcove. Princeton точки зрения вымирания – численность
Univ. Press, 2009. 848 pp. крупных, хотя и низка, зато относительно
3Как устроена экология, или чем стабильна.
отличается зрелая наука от незрелой. Soft 39Нужна более фундаментальная причина
Science (незрелая наука) Образ: для вымирания Такой причиной может быть
(филогенетический) газон. Hard Science накопление мутаций.
(зрелая наука) Образ: (филогенетическое) 40Мутации, в конечном счете,
дерево. Экология ближе к незрелой науке … единственный источник генетической
Пример зрелой науки - физика. изменчивости de novo. Однако благоприятных
4Идеал количественной науки. Открытие мутаций мало. Почти все мутации снижают
Леверье планеты Нептун: Леверье предсказал приспособленность. Неблагоприятные мутации
положение Нептуна, исходя из – летальные, вредные, слабовредные.
несоответствия между наблюдаемой орбитой Летальные и вредные с сильно выраженным
Урана и той, которая должна была бы быть эффектом отсекаются на индивидуальном
согласно законам Кеплера и Ньютона. Галле уровне, в эволюции большой роли не играют,
направил телескоп на указанную Леверье поскольку не могут быть переданы потомкам.
точку небесного свода и действительно Слабовредные, напротив, играют
нашел там новую планету! Схема Солнечной значительную роль в эволюции.
системы: 41Геномные – изменение числа хромосом
http://solarsystem.nasa.gov/planets/index. (например, полиплоидизация) Хромосомные
fm. 1846 г. – открытие Нептуна 1848 г. – (делеция, дупликация, инверсия и
избрание Леверье иностранным членом транслокация) Нуклеотидные (точковые) –
Петербургской Академии Наук. замены, делеции и вставки нуклеотидов.
5Определение экологии, или многое ли мы «Морфология» мутаций. Азотистые основания,
узнаём из определения науки. Теория входящие в ДНК и РНК. 3. 1. Аденин (A).
вероятностей – пример зрелой науки. Что же Гуанин (G). Цитозин (C). Тимин (T). Урацил
мы узнаем из определения теории (T). Два типа замен – транзиции и
вероятностей? Теория вероятностей – это трансверсии Азотистые основания – пурины
наука о вероятностях! ? Не следует слишком (аденин и гуанин) и пиримиды (цитозин,
многого ждать от определений … Обратимся к тимин и урацил) Транзиция – замена пурина
Советскому энциклопедическому словарю на пурин и пиримидина на пиримидин
(1982): «Вероятностей теория, раздел Трансвесия – замена пурина на пиримидин и
математики, в котором по данным пиримидина на пурин.
вероятностям одних случайных событий 42Классификация точковых мутаций «по
находят вероятности других событий, смыслу». Несинонимические нуклеотидные
связанных каким-либо образом с первыми.». замены, приводящие к замене аминокислоты,
6Как на этом фоне обстоит дело с - это и есть мутации в узком смысле, темп
определением экологии? Не так уж плохо! накопления которых у данного вида мы хотим
Экология – наука о взаимоотношениях найти. Сохранение смысла кодона из-за
организмов (популяций) между собой и с вырожденности генетического кода
окружающей средой. «Термин экология был (синонимическая замена нуклеотида)
введен Э. Геккелем в 1866 г. Биологический Изменение смысла кодона, приводящее к
энциклопедический словарь (1989) замене аминокислоты (несинонимическая
определяет экологию как «биологическую замена нуклеотида) Образование
науку, изучающую организацию и бессмысленного кодона (нонсенс-мутация,
функционирование надорганизменных систем или образование стоп-кодона) Мутация,
различных уровней: популяций, биоценозов обратная к 3), то есть замена стоп-кодона
(сообществ), биогеоценозов (экосистем) и на смысловой кодон. Вырожденность
биосферы» … Это определение может генетического кода: 61 кодон кодирует 20
нравиться или нет, но в самом существенном аминокислот.
оно бесспорно: экология – это 43Таблица генетического кода:
биологическая наука, изучающая синонимические и несинонимические замены.
надорганизменные системы. С другой Вырожденность генетического кода
стороны, в печати или в устной речи мы неравномерна! Схема с сайта:
постоянно сталкиваемся со словосочетаниями http://www.geneticsolutions.com/...530:187
типа «экология памятников», «экология .
языка», «экология культуры», даже 44Кольцевая ДНК митохондрий
«экология нашего двора». … Еще смешнее млекопитающих с указанным на ней
выглядят словосочетания «плохая экология» цитохромом b. Источник:
или «хорошая экология». Этак можно http://herkules.oulu.fi/isbn9514255364/htm
договориться до чего угодно. Скажем, в /x128.html. Codon Table.
моем любимом городе Феодосии «плохая 45Нуклеотидная последовательность для
геометрия»; евклидовы законы там не цитохрома b из GenBank (1140 bp).
соблюдаются, поскольку город расположен на >Desmana_moschata (выхухоль)
подковообразном склоне.» (Е.А. Нинбург. ATGACAAATATCCGAAAAACCCACCCCATTATAAAGATTATT
Введение в общую экологию. М. 2005, с. 6). ACGACTCTTTCATTGATTTACCAACACCATCAAACATTTCAT
7Экология как разномасштабная наука. CTGATGAAATTTTGGTTCGCTCTTAGGGATTTGCTTAGTTAT
Популяционная экология. Макроэкология. CAAATTATCACAGGACTATTCCTCGCAATACACTACACACCA
Более или менее универсальные инструменты ACACCATAACAGCCTTCTCATCAGTAACCCACATCTGCCGAG
популяционного анализа. Более или менее CGTAAACTACGGCTGACTTATCCGATACCTTCATGCAAACGG
универсальные экологические зависимости. GCTTCCATATTTTTTATTTGTTTATTCCTACATGTAGGTCGA
Локальный масштаб – почти полное GACTATATTATGGATCCTACATATTCACAGAAACTTGAAATA
отсутствие усреднения. Глобальный масштаб TGGAGTATTACTATTATTCGCCACTATAGCCACTGCATTCAT
– высокая степень усреднения. GGGTACGTTCTGCCATGGGGTCAAATATCCTTTTGAGGCGCA
8Эта схема не отрицает возможности CGGTAATTACAAATTTATTGTCAGCCATTCCTTACATCGGAA
создания теории экологических явлений как AGACCTTGTAGAATGAATCTGAGGAGGTTTTTCAGTAGATAA
в локальном, так и, тем более, в GCAACACTGACCCGATTTTTTGCTTTCCATTTTATTCTGCCA
глобальном масштабе. Она лишь пытается TCATTATTGCAGCTATGGCTGGCGTACATTTATTATTCCTTC
расставить приоритеты: поиск (более или TGAAACTGGTTCTAATAACCCTTCCGGACTGTTATCTGACGC
менее) универсальных инструментов в GACAAAATCCCATTCCACCCATATTATACCATTAAAGACACT
локальном масштабе и поиск (более или TAGGAGCCCTAGCCCTTATCACAGTATTATCCCTACTCGTAT
менее) универсальных зависимостей в ATTTTCACCAGACCTATTAGGAGACCCAGACAACTATACTCC
глобальном масштабе. GCCAACCCACTAAACACACCACCCCACATTAAACCAGAATGA
9Универсальный инструмент – что это? ACTTCCTATTCGCATACGCAATCCTACGTTCAATTCCTAACA
Своего рода термометр … Изображения с ACTAGGAGGTGTTTTAGCTCTAGTTATATCTATTCTAGTCCT
сайтов: GCACTAATACCATTCCTACATACCTCAAAACAACGAAGCATG
http://nkozlov.ru/library/s318/d3458/ TATTCCGACCTATTAGCCAATGCTTATTCTGATTACTAGTGG
http://picasaweb.google.com/olgazubko. CGACCTACTTGTATTAACATGAATTGGAGGCCAACCAGTAGA
10Содержание лекции: Две экологические CACCCTTTCATCATCATCGGCCAAGTAGCCTCAATCCTTTAC
задачи. Оценка рождаемости в популяциях TCCTCTTAATCCTAGTATTAATACCACTGGCAAGCATTATAG
планктонных животных как пример поиска AAACAACTTACTCAAATGA. Фото: Нелли Зарипова
«экологического инструмента» вероятность Источник:
оказаться под угрозой вымирания в http://www.biodiversity.ru/programs/vyhuh/
зависимости от темпа накопления мутаций у allery/photoalbum.html.
млекопитающих как пример поиска 46Как определяют темп накопления
экологической (эколого-генетической) мутаций. Отношение (относительного) числа
зависимости. несинонимических замен (большинство из
11Пример на тему популяционного анализа: которых слабовредные) к (относительному)
Как оценивают рождаемость дафний и что из числу синонимических замен есть мера темпа
этой оценки можно извлечь. накопления мутаций. Идем в GenBank
12Два основных эффекта – top-down и (http://www.ncbi.nlm.nih.gov/Genbank/ ) и
bottom-up. Как сравнить силу воздействия извлекаем из него нужную нам нуклеотидную
со стороны хищников (top-down effect) с последовательность Сравниваем нуклеотидные
силой воздействия со стороны пищи последовательности разных видов (sequence
(bottom-up effect)? Фото с сайтов alignment, или выравнивание), то есть
http://www.nwri.ca © NOAA, Ann Arbor, записываем их одну под другой, чтобы было
Michigan, www.biologie.uni-muenchen.de, © как можно больше совпадений, например. Вид
Wilfried Gabriel 1. T. g. t. A. C. c. T. C. g. T. g. G. -.
www.icb.ufmg.br/bot/ficolog. A. A. -. -. Вид 2. T. -. -. A. C. -. T. C.
13Размерно-избирательная элиминация a. T. a. G. c. A. A. c. c. На основании
планктонных рачков рыбами. Alosa (= сравнения строим филогенетическое дерево
Pomolobus) pseudoharengus. Brooks J. L., (исходя из того, что близкие виды имеют
Dodson S. L. Predation, body size, and сходные последовательности). В концевых
composition of plankton. Science. 1965. V. точках этого дерева находятся современные
150. P. 28-35. виды, а в ближайших узлах – их общие
14b = V ln(1 + FA) Демографические предки (т.е. реконструированные
показатели, влияющие на b: V = 1/De – последовательности) Сравниваем
скорость развития яиц, сут-1 F = E/Na – последовательности современных видов и их
плодовитость (отношение числа яиц к числу ближайших предков, выделяем триплеты
взрослых) A = Na/N– доля взрослых особей нуклеотидов, среди них находим
(от общей численности популяции). Модель различающиеся, а среди различающихся –
Эдмондсона-Палохеймо как (более или менее) триплеты с синонимическими заменами и
универсальный инструмент для оценки и триплеты с несинонимическими заменами.
анализа рождаемости планктонных животных. 47От (неблагоприятных) мутаций до
Фото с сайта www.biologie.uni-muenchen.de вымирания … Отбор. Дрейф. Неблагоприятные
©Wilfried Gabriel. мутации. Генетический груз. «Объем»
15ВЛИЯНИЕ СРЕДЫ НА РОЖДАЕМОСТЬ b мутаций подпитывается новыми мутациями,
опосредовано скоростью развития яиц V, сокращается «очищающим» отбором и
плодовитостью F и долей взрослых A. поддерживается генетическим дрейфом.
Температура. Скорость развития яиц V = Вымирание.
1/de. Пища. О к р у ж а ю щ а я с р е д а. 48Отбор. Дрейф. Соотношение между
Плодовитость F = E/na. b. Размерно- отбором и дрейфом зависит от численности.
избирательные хищники. Доля взрослых A = Высокая численность. Низкая численность.
na/N. Отбор неэффективен в популяциях с низкой
16Оценка роли V, F и A с помощью метода численностью, а дрейф – наоборот
вкладов. ?b ? ln(1+ F?A)??V + (population bottleneck – популяционное
[V?A/(1+F?A)]??F + [V?F/(1+F?A)]??A. y = f узкое место, «бутылочное горлышко»). Чем
(x1, x2, …, xn) ?y ? ? (?y/?xi) ?xi. b = V ниже численность, тем менее эффективен
ln(1+ F?A). ?b ? (? b/? V)??V + (? b/? отбор и более эффективен дрейф.
F)??F + (? b/? A)??A. Изменение 49Мутационное «таяние» популяции
рождаемости. Вклад изменения скорости (mutational meltdown). N1. N2 < N1.
развития яиц. Вклад изменения доли Воронка снижаю щейся числ енн ос т и.
взрослых. Вклад изменения плодовитости. Низкая численность. Сильный дрейф. Больше
Сумма вкладов в изменение рождаемости. генетический груз. Ниже рождаемость и выше
17Мы предполагаем, что: (1) При смертность. N2. Положительная обратная
преобладающем влиянии пищи ведущая роль в связь между низкой численностью, сильным
динамике рождаемости принадлежит изменению дрейфом и накоплением мутаций.
плодовитости (количеству яиц в расчете на 50Kr/Kc polarity. Kr/Kc volume. Ka/Ks.
одну взрослую самку). (2) При Kr/Kc polarity-volume. Kr/Kc charge.
преобладающем влиянии хищников ведущая Grantham distance. Comparison of averages
роль в динамике рождаемости принадлежит of six molecular traits for 55 small (ln W
изменению размерно-возрастной структуры – < 9.04) and 55 large (ln W > 9.04)
в силу того, что пресс хищников в mammals where 9.04 is the median of loge
планктоне обычно носит transformed body mass W (in grams).
размерно-избирательный характер. (3) Popadin K., Polishchuk L.V., Mamirova L.,
Соотношение эффектов плодовитости и доли Knorre D., and Gunbin K. 2007.
взрослых на рождаемость позволяет судить Accumulation of slightly deleterious
об относительной силе воздействия факторов mutations in mitochondrial protein-coding
внешней среды – пищи и хищников. genes of large versus small mammals. PNAS
18Проверка «инструмента» в лабораторных 104: 13390-13395. ©2007 by National
условиях. Динамика рождаемости Daphnia Academy of Sciences.
galeata в лабораторных микрокосмах при 51Kr/Kc volume. Ka/Ks. Kr/Kc polarity.
разном характере размерно-избирательной Grantham distance. Kr/Kc polarity-volume.
элиминации и сопряженной с ним разной Kr/Kc charge. The ordinary linear
пищевой обеспеченности. Polishchuk, L.V., regressions of molecular traits on loge
Vijverberg, J., Voronov, D.A., Mooij, W.M. body mass W for 110 mammalian species.
Separating Top-down from Bottom-up Effects Popadin K., Polishchuk L.V., Mamirova L.,
in Daphnia: Contribution Analysis of Birth Knorre D., and Gunbin K. 2007.
Rate (in preparation). Accumulation of slightly deleterious
19Общая характеристика эксперимента mutations in mitochondrial protein-coding
Постоянная температура (т.е. D = const) и genes of large versus small mammals. PNAS
световой режим, поддержание качественного 104: 13390-13395. ©2007 by National
состава пищи на одном и том же уровне Academy of Sciences.
Регулярное внесение пищи и регулярный темп 52Крупные звери накапливают больше
элиминации Только конкуренция за пищу и мутаций. Но достаточно ли этого для
размерно- выборочная элиминация действуют вымирания? До сих пор в нашем распоряжении
в системе, причем эти два фактора были только косвенные свидетельства …
действуют одновременно, хотя и с разной 53Вновь возвращаемся к Красной книге.
силой. Каков темп накопления мутаций у тех, кто
20Результаты. Численность Daphnia под угрозой, и у тех, кто не под угрозой?
galeata. No Removal. Removal-of-Small. Под угрозой. Не под угрозой. Структура
Removal-of-Large. Международной Красной книги (категории
21Результаты. Плодовитость Daphnia видов). EX – исчезнувшие EW – исчезнувшие
galeata. Removal-of-Small. в дикой природе CR – находящиеся на грани
Removal-of-Large. No Removal. исчезновения EN – исчезающие (в опасности)
22Вклады изменений плодовитости и доли VU – уязвимые NT – находящиеся в
взрослых в изменение рождаемости при состоянии, близком к угрожаемому LC –
отсутствии размерно-избирательной вызывающие наименьшие опасения DD –
элиминации (режим конкуренции – недостаток недостаточно данных NE – оценка не дана.
пищи). Con F – вклад изменения 54Темп накопления мутаций у
плодовитости. Con A – вклад изменения доли млекопитающих, относящихся к разным
взрослых особей. ?B – изменение категориям риска вымирания – от вызывающих
рождаемости (в расчете на сутки). Номер наименьшие опасения (LC) до находящихся в
интервала между пробами от начала опасности (EN и CR). Ka/ks – скорость
эксперимента. на-копления несиноними-ческих замен по
23Вклады изменений плодовитости и доли отношению к скорости накопления
взрослых в изменение рождаемости при синоними-ческих замен. Mean Ka/Ks for
избирательной элиминации взрослых дафний groups of mammals with a certain
(имитация пресса рыб). Con F – вклад conservation status which is established
изменения плодовитости. Con A – вклад according to the IUCN Red List and ranges
изменения доли взрослых особей. ?B – from least concern (LC, n = 122) to near
изменение рождаемости (в расчете на threatened (NT, n = 22) to vulnerable (VU,
сутки). Номер интервала между пробами от n = 29) to endangered (EN, n = 29) to
начала эксперимента. critically endangered (CR, n = 9) species.
24NR. RS. RL. Microcosm experiments. Means and standard errors (SE) are
Microcosm experiments. Microcosm originally calculated on the basis of log
experiments. Microcosm experiments. transformed data. The values presented in
Computer simulations. Computer the figure are obtained through back
simulations. Computer simulations. transformation (Sokal and Rohlf 1995:
Computer simulations. Сводка результатов 413-415).
лабораторных и компьютерных экспериментов. 55Метод (инструмент): Логистическая
NR (no removal) – режим конкуренции RS регрессия. Логистическая функция. Как
(removal-of-small) – элиминация молоди описать зависимость вероятности оказаться
дафний («пресс беспозв. Хищников») RL под угрозой вымирания от темпа накопления
(removal-of-large) – элиминация взрослых мутаций? Или. b > 0. b < 0.
дафний («пресс рыб»). Treat-ment. 56Зависимость вероятности оказаться под
Treat-ment. 1.28 (0.08). 0.14 (0.009). угрозой вымирания от темпа накопления
-0.35 (0.18). 0.70. 1.22 (0.13). 0.30 мутаций у млекопитающих (на материале 211
(0.02). -0.60 (0.50). 0.55. 2.05 (0.12). видов). Probability of being at risk
0.23 (0.012). 0.75 (0.32). 2.12. 2.35 (green line) in relation to mutation
(0.36). 0.27 (0.03). -0.29 (0.48). 0.75. accumulation rate, Ka/Ks, based on a
3.22 (0.05). 0.12 (0.008). 0.78 (0.24). logistic regression of the binary variable
2.18. 3.39 (0.30). 0.17 (0.03). 0.72 of least concern (LC) species, each of
(0.51). 2.05. which is assigned 0, vs. near threatened
25Вывод (по результатам лабораторных (NT), vulnerable (VU), endangered (EN) and
экспериментов). По соотношению вкладов critically endangered (CR) species
изменения доли взрослых и изменения combined, each of which is assigned 1, on
плодовитости в динамику рождаемости можно loge(Ka/Ks). For a regression equation see
исключить либо фактор пищи (когда text. Also shown are the frequency
отношение вкладов около 2), либо фактор distributions for the least concern (blue
рыб (когда отношение вкладов 0.5-0.7) как polygon with bars) and the more threatened
возможную причину динамики численности (NT+VU+EN+CR; red polygon with bars)
данной популяции дафний. Отличить эффект species. The red polygon is shifted to the
беспозвоночных хищников от эффекта пищи и right relative to the blue one (p <
эффекта рыб пока не представляется 0.005, Kolmogorov-Smirnov test), which
возможным, однако можно полагать, что manifests a generally increasing trend in
эффект беспозвоночных хищников лишь в extinction risk with increasing Ka/Ks.
редких случаях является доминирующим. However at the far right end of the
26Осталось проверить, приложим ли этот distributions the situation seems to be
инструмент к природным популяциям … Если reversed.
да, то: Мы пришли на берег водоема, 57Зависимость вероятности оказаться под
бросили планктонную сеть, подсчитали угрозой вымирания от темпа накопления
плодовитость и долю взрослых особей в мутаций.
популяции дафний и … определили ведущий 58Десять не находящихся под угрозой (LC)
фактор динамики численности этих дафний – видов млекопитающих с высокой скоростью
недостаток пищи (возможно, с «примесью» накопления мутаций (шесть из них приматы)
беспозвоночных хищников) или пресс рыб (эта скорость сравнима или даже
(опять же, возможно, с «примесью» превосходит верхнюю границу скорости
беспозвоночных хищников). Температура на накопления мутаций у видов, находящихся
нашем «экологическом термометре» – это под угрозой). Primates. Primates.
соотношение силы воздействия ведущих Primates. Primates. Primates. Primates.
экологических факторов. Фото: Е.А. Carnivora. Pilosa. Eulipotyphla. Pilosa.
Мнацаканова. Species. Common name. Order. Family.
27Пример на макроэкологическую тему: Status. Ka/Ks. loge (Ka/Ks). 1. Macaca
Вероятность оказаться под угрозой fascicularis. Яванский макак (крабоед).
вымирания в зависимости от темпа Cercopithecidae. LC. 0.1397. -1.97. 2.
накопления мутаций («генетического груза») Ursus arctos. Бурый медведь. Ursidae. LC.
у млекопитающих. 0.1223. -2.10. 3. Chlorocebus sabaeus.
28 Зеленая мартышка. Cercopithecidae. LC.
29Современное вымирание. Каков темп 0.1202. -2.12. 4. Chlorocebus aethiops.
накопления мутаций у тех, кто под угрозой, Гривет (Grivet Monkey). Cercopithecidae.
и у тех, кто не под угрозой? Под угрозой. LC. 0.1177. -2.14. 5. Bradypus
Не под угрозой. Источником данных по tridactylus. Трехпалый ленивец.
современному вымиранию является Красная Bradypodidae. LC. 0.1016. -2.29. 6.
книга. Международная Красная книга (IUCN Chlorocebus pygerythrus. Верветка
Red List) Структура Международной Красной (Vervet). Cercopithecidae. LC. 0.1001.
книги (категории видов). EX – исчезнувшие -2.30. 7. Chlorocebus tantalus. Tantalus
EW – исчезнувшие в дикой природе CR – Monkey. Cercopithecidae. LC. 0.0983.
находящиеся на грани исчезновения EN – -2.32. 8. Macaca mulatta. Макак-резус.
исчезающие (в опасности) VU – уязвимые NT Cercopithecidae. LC. 0.0981. -2.32. 9.
– находящиеся в состоянии, близком к Erinaceus europaeus. Обыкнов. ёж.
угрожаемому LC – вызывающие наименьшие Erinaceidae. LC. 0.0946. -2.36. 10.
опасения DD – недостаточно данных NE – Choloepus didactylus. Двупалый ленивец.
оценка не дана. Megalonychidae. LC. 0.0902. -2.41.
30Почему они вымирают? Внешний аспект 59По данным Международной Красной книги
вымирания. Квартет внешних факторов около половины современных приматов
(Diamond’s quartet), ведущих к вымиранию: находятся под угрозой вымирания – против
Разрушение природных местообитаний 25% «краснокнижных» видов от общего числа
Чрезмерная эксплуатация (неограниченная видов млекопитающих Полученные данные
охота, перевылов) Виды-вселенцы (особенно показывают, что приматов также
опасны для островных эндемиков) Цепная непропорционально много среди видов,
реакция вымирания (разрушение нижних которые в настоящее время находятся в
трофических уровней приводит к вымиранию безопасности, но при этом имеют высокий
верхних). темп накопления мутаций и поэтому являются
31Какие звери преимущественно вымирают? потенциальными кандидатами на вымирание.
Шерстистые мамонты (Mammuthus primigenius) 60Возможность прогноза. Десять не
в тундростепном ландшафте. Источник: находящихся в настоящее время под угрозой
Sedwick C. What Killed the Woolly Mammoth? видов млекопитающих с высокой скоростью
PLoS Biol 6(4): e99 (2008). накопления мутаций – это потенциальные
32Общее правило (тенденция): Вымирают кандидаты на то, чтобы оказаться под
преимущественно крупные звери. Пример: В угрозой вымирания. Эти виды
позднем плейстоцене (на большинстве предрасположены к тому, чтобы оказаться
континентов 12-15 тыс. лет назад) под угрозой вымирания в силу генетических
преимущественно вымирали крупные звери. причин Макроэкологический
Только ли под действием человека? Не были (сравнительно-видовой) анализ позволяет не
ли крупные предрасположены к вымиранию? только построить зависимость вероятности
Источник: S. K. Lyons, F. A. Smith and J. оказаться под угрозой вымирания от темпа
H. Brown. 2004. Of mice, mastodons and накопления мутаций, но и сделать прогноз,
men: human mediated extinctions on four какие виды могут оказаться под угрозой при
continents. Evolutionary Ecology Research дальнейшем нарастании антропогенного
6: 339-358. пресса.
33Кто кого «сборет»: человек пещерного 61Связка экологии с популяционной
медведя или наоборот? Пещерный медведь генетикой и биоинформатикой может быть
Художник: Зденек Буриан Источник: одной из точек роста современной биологии.
http://macroevolution.narod.ru/burian.htm. 62При изменении условий мутация исходно
34Гистограммы распределения выживших и вредная может оказаться полезной.
вымерших в позднем плейстоцене видов Классический пример превращения вредной
млекопитающих по массе тела. Материал тот мутации в полезную – меланизм березовой
же, что и на предыдущем слайде. 4 пяденицы (Biston betularia). Не думайте,
континента, 2123 вида. что все мутации вредные. Полезные мутации
35Крупные звери размножаются медленнее. тоже бывают ? Поскольку речь шла о
rm ~ W-0.27. Для сравнения показана вымирании, нас интересовали здесь только
зависимость удельного обмена от массы (с не-благоприятные мутации. Таких
показателем степени -0.25). Log (уд. действительно большинство. Тем не менее не
Скорость роста численности, rm). Log все мутации неблагоприятные (например,
(масса тела, W). Источник: Fenchel T. возникновение устойчивости к антибиотикам
1974. Oecologia 14: 317-326, Figure 1. – мутация, полезная для бактерий). А. Б.
36Медленно размножающиеся звери не Пятнистая и темная формы березовой
только чаще вымирают, но и чаще пяденицы на стволе, покрытом лишайником
оказываются под угрозой вымирания. Chance (слева), и на темном стволе без
of listing – технический термин, лишайников. До эры индустриального
означающий, вероятность попасть в Красную меланизма на березе жили лишайники (а).
книгу. Источник: Polishchuk L.V. Потом лишайники погибли, а кора почернела
Conservation priorities for Russian (б). Фото:
mammals. 2002. Science 297: 1123. http://bill.srnr.arizona.edu/classes/182/M
37Зависимость плотности популяции N lanism/Kettlewell.htm.
Общая экология.ppt
http://900igr.net/kartinka/ekologija/obschaja-ekologija-80071.html
cсылка на страницу

Общая экология

другие презентации на тему «Общая экология»

«Игры по экологии» - Игры с игрушками-аналогами. Игр в экологии. Рыбки. Загадывание загадок о зайце. Развитие познавательной деятельности у ребенка. Предварительная работа. Учить детей различать признаки весны. Сюжетно-дидактическая игра «Карлсон гостит у детей». Игры с литературными персонажами. Игровые роли. Сюжетно – дидактическая игра « На рыбалку с котом Леопольдом».

«Игра по экологии» - Внимание! В сосуде водица, ею нельзя напиться. (Кровь). Какое растение носит название глаза птицы? (Вороний глаз). Какие птицы не садятся на землю? (Ласточки, стрижи). Приветствуем участников игры. Какое растение раскрыло законы наследственности? (Горох). В маленькие дверцы весь мир входит. О ком идет речь? (Як).

«Экология в детском саду» - Тайны здоровой пищи. Почему расцвечиваются листья? 4.Экскурсии. 7.Наблюдения. Детская фантазия. 3.Уроки мышления. Отдыхаем в лесу. Как заботиться о комнатных растениях? Где ночуют птицы? Покормите птиц зимой. Что мы знаем о собаке? Эколого-нравственный блок. Такие вкусные и опасные (о ягодах, фруктах, овощах).

«Основы экологии» - Компоненты биоценоза. Инфузорий –туфелек поместили в закрытую пробирку. Основы экологии. Основные понятия. Задания для самоконтроля. Популяция – совокупность особей одного вида. Задания к теме «Зависимость организмов от факторов среды». Организмы. Схема действия экологического фактора. В водоем запустили карпов.

«Развитие экологии» - III Ботанический конгресс (Брюссель, 1910). Экология нашествий животных и растений, 1958. «История животных» Классификация по образу жизни, способу питания. Ф.Клементс «О сукцессии растительных сообществ», 1929. Роберт Бойль (1627–1691). Пятый этап развития экологии. Концепция климакса. Круговорот. Динамика популяций.

«Экология города» - Архитекторы: придумайте и спроектируйте свой «чистый» город! Вы знаете? Что такое экология? Наш город будет самым лучшим и безопасным! Что делать, чтобы выжить в городе? Создаем команды! Какие болезни Вы бы могли назвать, вызванные загрязнениями окружающей среды? Можно ли сделать город безопасным? По-вашему кто-нибудь в нашем городе занимается вопросами экологии?

Экология

25 презентаций об экологии
Урок

Экология

30 тем
Картинки