Передача информации
<<  Невербальные средства передачи информации Передача информации в компьютерных сетях (КС). Структура КС. Локальные КС  >>
Один из возможных типов сигналов (= регуляций):
Один из возможных типов сигналов (= регуляций):
Даны n последовательностей
Даны n последовательностей
Индуктивный шаг: от
Индуктивный шаг: от
Пример
Пример
Работа алгоритма:
Работа алгоритма:
Результат работы алгоритма:
Результат работы алгоритма:
Качество потенциального сигнала растет в процессе счета:
Качество потенциального сигнала растет в процессе счета:
Последовательное изменение качества сигнала в ходе алгоритма:
Последовательное изменение качества сигнала в ходе алгоритма:
Параллельная реализация вычислительно трудоемких алгоритмов: поиск
Параллельная реализация вычислительно трудоемких алгоритмов: поиск
Реальные еще очень простые вторичные структуры (=наборы спиралей):
Реальные еще очень простые вторичные структуры (=наборы спиралей):
Примеры результатов счета в этой модели
Примеры результатов счета в этой модели
?Конфигурация
?Конфигурация
Решение (фрагмент): эволюция предкового сигнала
Решение (фрагмент): эволюция предкового сигнала
Картинки из презентации «Институт проблем передачи информации РАН» к уроку информатики на тему «Передача информации»

Автор: Vassily Lyubetsky. Чтобы познакомиться с картинкой полного размера, нажмите на её эскиз. Чтобы можно было использовать все картинки для урока информатики, скачайте бесплатно презентацию «Институт проблем передачи информации РАН.ppt» со всеми картинками в zip-архиве размером 792 КБ.

Институт проблем передачи информации РАН

содержание презентации «Институт проблем передачи информации РАН.ppt»
Сл Текст Сл Текст
1Институт проблем передачи информации 36TTGACAACAG=CATTAACTATCTGTAATAAT Zygnema
РАН (http://www.iitp.ru) Лаборатория TTGACAAATA=AACATCATTT=TGGCATAAT Mesostig
математических методов и моделей в TTGATTAATATAA=ATTAATTA=GTTATAAT
биоинформатике (http://lab6.iitp.ru). Bigelowiel.
д.ф.-м.н. проф. зав лаб Любецкий Василий 37
Александрович (lyubetsk@iitp.ru). 38Пример интересной темы для
2С 2000 года нами опубликовано: 2 исследования – связь (РЕР) промоторов и
монографии и 1 вузовский учебник (по предпочитаемых ими сигма-субъединиц.
математике) и 23 статьи в математических Например, нами показано, что промотор С
журналах (Успехи мат. наук, Труды предпочтительно связывает Sig4-субъединицу
института им. Стеклова, Мат. Заметки и РНК-полимеразы. Аналогично для фаговых
т.д.). А также – опубликовано 36 статей в промоторов и полимераз.
биологических и информатических журналах 39Переходы, возможные в нашей модели
(Молекулярная биология, Биофизика, регуляции, которая связана со спиралями:
Биохимия, FEMC, ВМС, JBCB, inSB, ...) (1) Правый конец y окна сдвигается на один
Подготовлено 2 докторские и 3 кандидатские нуклеотид вправо или остается на месте или
диссертации (все – физ.-мат. науки, подается сигнал «Т». Альтернатива: когда
«теоретические основы информатики», правый конец y доходит до начала гена, то
«биоинформатика»). подается сигнал «А». При этом вторичная
3Ежегодно наши аспиранты и сотрудники структура в окне формирует выбор между Т
делают доклады примерно на 4-х или А; (2) Левый конец x окна сдвигается
международных конференциях на три нуклеотида вправо или остается на
(математических, биологических, месте, что зависит от частоты c
информатических) За это время аспиранты и предшествующего считывания регулируемого
сотрудники приняли участие в выполнении: гена; (3) Вторичная структура
25 грантов, 2 целевых грантов, 2 научных преобразуется в окне, т.e. текущая
программ и 2 совместных тем по линии вторичная структура ? трансформируется в
РАН-СНРС. Лауреаты премии «За лучшую новую структуру ?'.
публикацию в журнале Молекулярная 40В модели с предыдущего слайда ищется
биология» за 2005 год и премий некоторых (выход алгоритма) зависимость p(c) –
зарубежных университетов. частота наступления состояния «Т»
4Тесно сотрудничаем с кафедрой (несчитывания гена), при каждом
«математической логики и теории фиксированном значении частоты считывания
алгоритмов» мех-мата МГУ, в частности, («концентрации») c. При наличии такой
читаем там курс «Модели и алгоритмы в регуляции график p(c) имеет вид,
биоинформатике». Сотрудничаем с показанный на слайдах 24 и 25. При ее
факультетом биоинформатики и биоинженерии отсутствии график p(c) имеет вид почти
МГУ, с факультетом ВМК. Регулярно ведем постоянной функции или даже убывающей
курсовые и дипломные работы, аспирантов. функции.
Сотрудничаем с аспирантурой Париж-7. 41Что можно читать по этим темам: 1а)
Включая оплачиваемую работу. тип сигнала – «вторичная структура»:
5Проблемы эффективности; 2) Модели и [Lyubetsky, Pirogov, Rubanov, Seliverstov,
алгоритмы основных молекулярных процессов 2007, Journal of Bioinformatics and
в клетке: геномы бактерий, растений, Computational Biology, vol 5, no 1, p.
водорослей и простейших ..... ДНК=геном – 155-180], 1b) тип сигнала – «промотор»:
последовательность в 4х-буквенном алфавите [Селиверстов, Лысенко, Любецкий, 2009,
{A,C,T,G} с характерной длиной 3 миллиона Физиология растений РАН, том 56, № 5;
– 6 миллиардов позиций. Каждая буква Seliverstov, Lyubetsky Молекулярная
называется «нуклеотид». биология, представлена] 2) Модели эволюции
6Модели и алгоритмы (компьютерный этих регуляций, т.е. эволюции сигналов 1а
счет). Данные. Результат. и 1b: [Любецкий, Жижина, Рубанов, 2008,
7Ген считывается по сигналу из лидерной Гиббсовский подход в задаче эволюции
области! Ген и сигнал эволюционируют! регуляторного сигнала экспрессии гена,
Лидерная область 2. Лидерная область 3. ППИ, №4; Горбунов, Любецкий МолБио,
Ген 1. Ген 2. Ген 3. Сигнал 2. Сигнал 3. представлена] Статьи можно получить от
инструкция для химической реакции – авторов по адресу: gorbunov@iitp.ru.
создается фермент; или для создания другой 42Наши биологические результаты (дает
молекулы: белка или РНК. Инструкция для некоторый обзор, для слушателей не
химической реакции 2. Инструкция для обязателен). 1. Проведена реконструкция
химической реакции 3. эволюционных событий молекулярного уровня:
8Один из возможных типов сигналов (= построены деревья белков и согласующие их
регуляций): деревья видов, найдены события
9Даны n последовательностей. Задача: потенциальных горизонтальных переносов,
найти систему сай-тов (=сигнал,мотив) s = потерь и дупликаций генов, случаи массовой
{s1,...,sk}, состоящую из сайтов дупликации генов в предковом геноме,
s1,...,sk, где k ? n. Все сайты имеют статистические характеристики эволюционных
одинаковую длину. Определяем качество событий по вершинам дерева видов и по
системы как сумму попарных близостей таксономическим группам, сравнивались
сайтов, составляющих систему (=качество сценарии горизонтальных переносов против
сигнала). Leader region 1. Leader region дупликаций и потерь генов. [In the book:
n. Bioinformatics of Genome Regulation and
10Ищем систему сайтов с максимальным Structure II. Springer Science &
значением качества, т.е. ищем минимум Business Media, Inc. 2005].
целевого функционала F в пространстве всех 432. Предложены новые типы регуляции
возможных систем: экспрессии генов: 2.1 Регуляция на уровне
11Индуктивный шаг: от ?1(•) и ?2(•) трансляции, опосредован-ная Т-боксом,
переходим к ?(•) по правилу: ? лучшая например, гена ileS, кодирующего
система ?1(?)+?2(?), полученная пере-бором изолейцил-тРНК синтетазу, у
всех ? и ? в *последователь-ностях. Идея Актинобактерий. [BMC Microbiology, 2005,
нашего алгоритма. Делим все 5:54; Молекулярная биология, 2005, 39(6)]
последовательности на две примерно равные 2.2 Регуляция на уровне трансляции
части и лучшую систему в одной части посредством взаимодействия рибосомы,
объединяем с лучшей системой в другой транслирующей лидерный пептид, и вторичной
части. Пусть ?1(?) – лучшая система в структуры РНК для гена leuA, кодирующего
одной части как функция от ? (и 2-изопропилмалатсинтазу, у Актинобактерий
фиксирована последовательность *), а ?2(?) («LEU-элемент»). [BMC Microbiology, 2005,
– аналогичная система в другой части как 5:54; Молекулярная биология, 2005, 39(6)].
функция от ? . Lead. reg. 1. Lead. reg. n. 442.3 Сложные типы классической
12Пример. Даны n=14 последовательностей, аттенюаторной регуляции (когда
каждая с длиной m=201; ищем систему сайтов антитерминатор не альтернативен
с длиной 15. терминатору), например, у лактобацилл
13Работа алгоритма: перед геном ilvD: это – цепь спиралей или
14Результат работы алгоритма: псевдоузел. [готовится к печати] 2.4
15Качество потенциального сигнала растет Аттенюаторная регуляция генов cysK синтеза
в процессе счета: Quality. Iteration. цистеина у Актинобактерий, вовлекающая
16Последовательное изменение качества ро-белок для терминации транскрипции:
сигнала в ходе алгоритма: Quality. рибосома, транслирующая лидерный пептид,
Iteration. перекрывает сайт связывания ро-белка. [BMC
17Параллельная реализация вычислительно Microbiology, 2005, 5:54] 2.5 Регуляция
трудоемких алгоритмов: поиск гена leuA у альфа-протеобактерий,
мультибоксового регуляторного сигнала в вовлекающая ген лидерного пептида и
группе геномов. Волновая вычислительная консервативный псевдоузел
схема на двумерной ?-сети перестановок («LEU1-регуляция»). [готовится к печати].
мощностью порядка n2 (в полном 452.6 Регуляция, опосредованная
пространстве n! перестановок): отсутствует аномально длинной спиралью РНК, генов,
жёсткая привязка к числу процессоров кодирующих транспортёры двухвалентных
кластера линейный рост производительности катионов (mntH) и ферменты, зависимые от
от числа доступных процессоров в широком металлов (никель-зависимая глиоксалаза и
диапазоне (проверено на МВС-1000М МСЦ, до др.), у бруцелл. Выясняется роль этой
512 CPU). «Однобоксовый» сигнал: - полный регуляции в выживании бруцеллы при
перебор O(mn) наш алгоритм O(n2m3) незавершённом фагоцитозе (бруцеллез).
«Двухбоксовый» сигнал: - полный перебор [Биофизика, в печати] 2.7 Статистические
O(mndn) наш алгоритм O(n2m3d3) (n – число данные о расположении длинных спиралей в
последовательностей, m – максимальная геномах Актинобактерий относительно
длина, d – интервал расстояний между кодирующих областей: длинные спирали
боксами сигнала). Пример для n=45, m=201, концентрируются в некодирующих областях
8 CPU. вблизи 3'-концов высоко экспрессируемых
18Wavelike computation scheme. Using 2D генов (включая тРНК) или между сходящимися
queue of permutations (P,Q) instead of навстречу друг другу генами. Выясняется
straight one. n=45, m=201, l=15, 8 CPU’s. роль таких шпилек в снятии
P0(0) ? 175.8. P1(1) ? 206.0. P2(2) ? конформационного напряжения ДНК и при
201.6. 260.6. P3(3) ? 260.6. P4(4) ? терминации транскрипции путем образования
211.7. P5(5) ? 198.8. P6(6) ? 197.6. P7(7) крест-шпилек на ДНК. [МолБиол, 2007,
? 207.7. P8(59) ? 218.7. P9(68) ? 184.2. 41(4)].
P10(79) ?… 214.2. ?Q0,0(11) 226.6. 463. Найдены новые случаи известных
?Q1,0(12) 242.1. ?Q2,0(14) 244.9. типов регуляции у бактерий: 3.1
?Q3,0(13) 211.6. ?Q4,0(8) 189.7. ?Q5,0(10) Предсказана белок-ДНКовая регуляция на
276.1. ?Q6,0(9) 267.2. ?Q7,0(15) 227.7. уровне транскрипции и также промоторы
?Q8,0(66) 207.7. ?Q9,0(75) 260.7. генов синтеза пролина у протеобактерий
?Q0,1(18) 178.6. ?Q1,1(19) 250.1. 250.1. родов Pseudomonas и Shewanella.
?Q2,1(22) 212.5. ?Q3,1(21) 217.8. [Молекулярная биология, 2007, 41(3)] 3.2
?Q4,1(17) 213.3. ?Q5,1(16) 274.0. Предсказано много случаев белок-ДНКовой
?Q6,1(20) 287.0. 287.0. ?Q7,1(23) 191.0. репрессии/активации. В частности,
?Q8,1(76) 204.5. ?Q0,2(26) 190.3. охарактеризован GlpR-регулон (регуляция
?Q1,2(27) 239.1. ?Q2,2(31) 195.7. метаболизма глицерол-3-фосфата).
?Q3,2(28) 202.8. ?Q4,2(25) 195.5. [Молекулярная биология, 2003, 37(5) –
?Q5,2(24) 273.6. ?Q6,2(30) 254.5. совместно с М.С. и его сотрудниками].
?Q7,2(29) 204.5. 292.0. ?Q0,6(58) 292.0. 473.3 Проведен широкомасштабный поиск
?Q1,6(60) 249.6. ?Q2,6(63) 266.0. =====. регуляции на уровне транскрипции
?Q4,6(57) 196.2. ?Q5,6(56) 287.9. посредством Т-боксов. [Молекулярная
?Q6,6(61) 275.1. ?Q7,6(62) 190.0. биология, 2005, 39(6)] 3.4 Предсказана
?Q0,7(67) 274.0. =====. ?Q2,7(70) 267.6. классическая аттенюаторная регуляция: (a)
?Q4,7(65) 206.5. ?Q5,7(64) 279.2. у протеобактерий (включая
?Q6,7(71) 274.0. ?Q7,7(69) 198.0. дельта-протеобактерии) и у видов из
?Q0,8(74) 202.7. ?Q2,8(78) 234.2. таксономических групп бацилл/клостридий и
?Q4,8(73) 184.4. ?Q5,8(72) 264.4. =====. бактероидов [FEMS 2004], (b) у
?Q7,8(77) 193.0. Актинобактерий [BMC Microbiology, 2005,
19Параллельная реализация вычислительно 5:54].
трудоемких алгоритмов: реконструкция 483.5 Предсказана регуляция на уровне
эволюции регуляторного сигнала в группе трансляции посредством тиаминового
геномов. Усовершенствованная параллельная рибопереключателя для гена ykoE,
схема аннилинга MC3 (= Metropolis-Coupled кодирующего субъединицу ABC транспортёра:
Markov Chain Monte-Carlo): лучшее покрытие происходит перекрывание сайта связывания
множества минимальных конфигураций меньшая рибосомы иногда прямо черенком
зависимость от выбранной начальной точки рибопереключателя, а иногда дополнительной
более быстрая сходимость к одному из спиралью РНК – происходит быстрая смена
предполагаемых абсолютных минимумов этих механизмов регуляции у очень близких
функционала «энергии». Индивидуальные видов (показана эволюция этого механизма).
режимы охлаждения. Периодический обмен [Информационные процессы, 2006, 6 (1)].
параметрами охлаждения между находящимися 494. Белок-РНКовая регуляция в
в окрестности различных локальных или пластидах: 4.1 Корреляция сплайсинга с
условных минимумов цепями с разной белок-РНКовой регуляцией трансляции в
температурой способствует выходу из хлоропластах растений и водорослей.
оврагов и локальных минимумов поверхности [Journal of Bioinformatics and
отклика. Computational Biology, 2006, 4, 4, 783;
20x. y. Показана лидерная область перед Биофизика, 2006, 51, тематический выпуск
геном, в ней «окно» с концами x и y, а в 1] 4.2 Связь вторичной структуры РНК с
окне образуются «спирали». Ген. Левое редактированием инициирующего кодона в
плечо. Правое плечо. хлоропластах у мхов и папоротников.
21«Спираль» с «плечами», склеиваются G с [Биофизика, 2006, 51, тематический выпуск
C и A с T: 1] 4.3 Найдена высоко консервативная
22Реальные еще очень простые вторичные регуляция экспрессии генов psaA, psbA и
структуры (=наборы спиралей): psbB (вне связи со сплайсингом) [Journal
23T. A. Два состояния сигнала. Результат of Bioinformatics and Computational
определяется тем, какая из двух Biology, 2006, 4(4)].
альтернативных вторичных структур 504.4 Найдена ортологичная
образуется: «Т» или «А». Лидерная область. консервативная регуляция гена ycf24 на
24Результат одной нашей моделей уровне трансляции в пластидах красных
регуляции: водорослей и паразитов из таксона
25Примеры результатов счета в этой Apicomplexa (Eimeria tenella, Plasmodium
модели. Мы считали функцию p=p(c) для spp., Toxoplasma gondii). Более того, у T.
практически всех лидерных областей gondii эта регуляция охватывает и много
аминокислотных оперонов и аминоацил-тРНК других генов, включая те, которые кодируют
синтетаз. Имеется высокое согласие с РНК-полимеразу: этот ген кодирует белок
экспериментом, с одной стороны, и SufB, необходимый для формирования
предсказание многих новых случаев такой железосероцентров. Выясняется роль пластид
регуляции, с другой стороны. Здесь в жизни токсоплазм на молекулярном уровне.
показаны thrA опероны у [Мол. биология, в печати].
гамма-протеобактерий. 515. Промоторы бактериального типа в
26Два основных направления нашей работы пластидах и соответствующие им
в Биоинформатике: Модели и алгоритмы сигма-факторы у растений и водорослей: 5.1
регуляции генов, Модели и алгоритмы Изучена быстрая эволюция промоторов перед
эволюции этих регуляций (=сигналов). геном ndhF, чья транскрипция у Резушки
27Дано дерево G , у которого длины ребер Таля (Arabidopsis thaliana) существенно
соответ-ствуют времени переходу от предка зависит от сигма-субъединицы Sig4.
к потомку. Даны современные [Физиология растений, в печати]. 5.2
последовательности. Ищем все предковые Предсказано, что кодируемая в ядре
последовательности. сигма-субъединица Sig4 РНК-полимеразы
28Иногда ищется и само дерево : тогда бактериального типа существовала уже у
даны только современные предка высших двудольных растений и у него
последователь-ности. Эти заданные же имелся Sig4-зависимый промотор:
последовательности – организмы, виды, соответствующие кДНК sig4 найдены по базе
гены, белки, сигналы. EST у винограда Vitis vinifera и двух
29?Конфигурация ? Классическая видов апельсина Citrus clementina и C.
аттенюаторная регуляция биосинтеза sinensis (у апельсинов это псевдоген).
треонина у гамма-протеобактерий. VC = Также известен псевдоген sig4 у тополя
Vibrio cholerae, VV = Vibrio vulnificus, Populus trichocarpa. А Sig4-зависимые
VP = Vibrio parahaemolyticus, AB = промоторы предсказаны в хлоропластах у
Actinobacillus actinomycetemcomitans, HI = всех видов из таксона Eurosids II (включая
Haemophylus influenzae, PQ = Mannheimia крестоцветные, апельсин и хлопок), а также
haemolytica, VK = Pasterella multocida, YP у нескольких далёких представителей
= Yersinia pestis, EO = Erwinia двудольных: эвкалипта, винограда и
carotovora, TY = Salmonella typhi , XCA = платана.
Xanthomonas campestris, EC = Escherichia 525.3 Исследованы Sig3-зависимые
coli, KP = Klebsiella pneumoniae, SON = промоторы перед геном psbN у семенных
Shewanella oneidensis. растений и показано общее! для всех
30Наша модель эволюции сигнала: Такая однодольных растений значительное отличие
функция минимизируется с помощью алгоритма области этого промотора от прочих
аннилинга. На каждом его шаге текущая цветковых растений.
конфигурация заменяется на новую из 535.4 Найдены высоко консервативные
определенного списка возможностей с хлоропластные промоторы бактериального
вероятностью или остается прежней с типа перед генами rbcL, psaA, psbA, psbB,
вероятностью . Нами доказана сходимость к psbE у большинства видов из Streptophyta.
глобальному min при условии. Более того, промотор перед геном psbA,
31?'j. Показано одно ребро от некоторой кодирующим белок D1 второй фотосистемы,
конфигурации ?. На этом ребре за время tj одинаков у Streptophyta, включая рано
происходят: замены букв со скоростями R, отделившиеся роды Mesostigma и
вставки букв и делеции букв. Сначала Chlorocybus, и у вторичного симбионта
выравниваем позиции у ?j и ?'j, при этом Bigelowiella natans из таксона Cercozoa.
возникают пустые позиции. Длины участков с 545.5 Найдены промоторы перед геном
пустыми позициями обозначим ljm. Тогда: rps20 и близлежащие сайты связывания
?j. tj. Слагаемое H1(?) в функции H. J-е транскрипционного фактора (– ортолога
ребро. NtcA) в хлоропластах красных и
32Показано одно ребро от конфигурации ?. криптофитовых водорослей. При этом сайт
На этом ребре произошел переход от для NtcA найден тогда и только тогда,
вторичной структуры hj в ?j к вторичной когда дивиргентно располагается ген glnB.
структуре h'j в ?'j. hj. Тогда: ?j. h'j. У цианобактерий оба белка NtcA и GlnB
Слагаемое H2(?) в функции H. ?'j. J-е вовлечены в регуляцию генов метаболизма
ребро. азота и их взаимная регуляция показана (в
33Решение (фрагмент): эволюция частности, NtcA активирует транскрипцию
предкового сигнала. glnB). На этом основании предсказана
34Поиск и эволюция сигнала другого типа регуляция в хлоропластах по механизму
(«промотора»): некоторой комбинации слов с конкуренции РНК-полимераз,
условиями на них и расстояния. Ttgaca транскрибирующих гены на противоположных
...17-18н... Tataat стр. Ген. цепях ДНК, причем также происходит
35На следующем слайде показан активация транскрипции glnB.
удивительно консервативный (=устойчивый 556. Найдена общая белок-ДНКовая
при эволюции) прмотор (перед геном psbA в регуляция экспрессии ядерных генов,
пластидах). На слайде через один показан кодирующих рубредоксин и киназу,
противопо-ложный случай: быстро фосфорилирующую белки по тирозину, у
эволюционирующий (меняющийся) промотор диатомовой водоросли Thalassiosira
среди цветковых растений (перед геном ndhF pseudonana и у паразитов родов Theileria и
в пластидах). Он имеет четыре варианта A, Babesia.
B, C, D, сменяю-щие друг друга. Сами эти 56Эти виды являются вторичными
промоторы найде-ны, но здесь не приведены. симбионтами и имеют пластиды с общим
36TTGACATGGCT=ATATAAGTCATGTTATACT происхождением от красных водорослей.
Arabidop Однако их ядерные геномы сильно
TTGACACGGG=CATATAAGGCATGTTATACT...ASpinaci отличаются. Поэтому можно предполагать
TTCACGATA==TATATAAGTCATACTATACT Cycas связь этой регуляции с пластидами.
TTGACATACA=GATATGTCTCATATTATACT Cryptomer Интересно, что киназы обычно участвуют в
TTGACATTGAT=ACATGGATCATATTATACT Pinus регуляторных каскадах, передающих сигнал
TTGACTTTAAT=AAACCATTTCTGTTATACT Welwitsch от некоторой мембраны, в частности, от
TTGACACGGAT=AGGTTTTT=GTGATATGCT Adiantum пластиды. Пластиды у диатомовых водорослей
TTGACATCAAT=AGATAAGTTGTGTTATACT Angiopter и паразитов Apicomplexa похожи, а ядерные
TTGACATATAT=GGAAAGATCATGTTATACT Psilotum геномы значительно различаются. С другой
TTGACACAAA=AAGAAAGATTGTGTAATATT Huperzia стороны, у криптофитовых водорослей
TTGACATAC=TAATGGGATATGTGTAATAAT Aneura рубредоксин кодируется в нуклеоморфе, т.е.
TTGACATAA=TCATATGTTATGTGTAATACT Marchantia непосредственно связан с пластидами.
TTGACATAA=TAATACATTTTGTGTAATACT Physcomitr Поэтому можно предположить, что эти очень
TTGACATTT=TTATACTTTACATACTATAAT Chara близкие регуляторные механизмы связаны с
TTGACATTAGTTATACGT=TTGTGCAATACT Chaetospha появлением пластид.
TTGACAGCT=TAAGGTTAAT=ATGTAATAAT Staurastr
Институт проблем передачи информации РАН.ppt
http://900igr.net/kartinka/informatika/institut-problem-peredachi-informatsii-ran-180069.html
cсылка на страницу

Институт проблем передачи информации РАН

другие презентации на тему «Институт проблем передачи информации РАН»

«Раны и кровотечения» - Для уменьшения кровотечения достаточно поднять поврежденную конечность выше уровня туловища. Оказание помощи при ранах. Ранения мягких тканей волосистой части головы всегда опасны. Ранения живота с выпадением внутренних органов. Основы медицинских знаний. Любые ранения лица всегда крайне опасны для жизни.

«Передача электроэнергии» - Поэтому возникает необходимость в передаче электроэнергии на большие расстояния. 110 кВ. Потребители электроэнергии имеются повсюду. Повышающий трансформатор. Понижающий трансформатор. К потребителю. 11 кВ. 35 кВ. Передача электроэнергии. Линия передачи. Потребление электроэнергии. 220 в. Тепловые потери.

«Передача информации по сети» - Локальные и глобальные компьютерные сети. По территориальной распространенности. По принадлежности. Между собой компьютеры (сетевые адаптеры) соединяются, например, с помощью кабелей. Региональные компьютерные сети. Шина. Глобальная вычислительная сеть. Кольцо. Звезда. Локальная вычислительная сеть, ЛВС ( англ.

«Обработка раны» - Обработка раны. Промывание раны перекисью водорода. Рваные или ушибленные раны (следствие воздействия относительно острого твердого предмета). Правовые аспекты оказания первой медицинской помощи. Остановка кровотечения. Наложение стерильной повязки. Укушенные раны (нанесены зубами животного или человека).

«Передача данных» - Контрольная последовательность. Затем для каждого процесса осуществляется прием-передача данных. Поле управления. На следующем этапе передачи данных выполняется протокол сетевого уровня. Начальный разделитель. Структура таблицы маршрутизации приведена на рис. 12. Транспортный уровень оговаривает порядок передачи и доступа к удаленным файлам.

«Передача информации в компьютерах» - Не требует приобретения дорогостоящей аппаратуры. Постоянное подключение - компьютер подключен к сети постоянно к быстрому каналу. Один компьютер специально выделяется для хранения файлов и программных приложений. Виды подключения к INTERNET. Компьютерные сети. Оплата взимается за каждый час работы в сети.

Передача информации

14 презентаций о передаче информации
Урок

Информатика

130 тем
Картинки
900igr.net > Презентации по информатике > Передача информации > Институт проблем передачи информации РАН