Генетика
<<  Паразитизм простейших Итоги деятельности АМОУ СОШ п.Пола за 2013-2014 учебный год  >>
Макроэкология (= сравнительно-видовая экология) + популяционная
Макроэкология (= сравнительно-видовая экология) + популяционная
Пять основных слагаемых процесса эволюции
Пять основных слагаемых процесса эволюции
Мутации, в конечном счете, единственный источник генетической
Мутации, в конечном счете, единственный источник генетической
Геномные – изменение числа хромосом (например, полиплоидизация)
Геномные – изменение числа хромосом (например, полиплоидизация)
Источник: Wikipedia
Источник: Wikipedia
Классификация точковых мутаций «по смыслу»
Классификация точковых мутаций «по смыслу»
Таблица генетического кода: синонимические и несинонимические замены
Таблица генетического кода: синонимические и несинонимические замены
Как определяют темп накопления мутаций
Как определяют темп накопления мутаций
Нуклеотидная последовательность для цитохрома b из GenBank (1140 bp)
Нуклеотидная последовательность для цитохрома b из GenBank (1140 bp)
Кольцевая ДНК митохондрий млекопитающих с указанным на ней цитохромом
Кольцевая ДНК митохондрий млекопитающих с указанным на ней цитохромом
Как определяют темп накопления мутаций (продолжение)
Как определяют темп накопления мутаций (продолжение)
От (неблагоприятных) мутаций до вымирания …
От (неблагоприятных) мутаций до вымирания …
Генетический дрейф – роль случайности в эволюции
Генетический дрейф – роль случайности в эволюции
Отбор
Отбор
Мутационное «таяние» популяции (mutational meltdown)
Мутационное «таяние» популяции (mutational meltdown)
Вероятность фиксации нейтральной мутации (s = 0)
Вероятность фиксации нейтральной мутации (s = 0)
Вероятность фиксации мутации (общий случай)
Вероятность фиксации мутации (общий случай)
Варианты базовой формулы для вероятности фиксации
Варианты базовой формулы для вероятности фиксации
Вероятность фиксации мутации в зависимости от s и Ne
Вероятность фиксации мутации в зависимости от s и Ne
Немного математики в подтверждение того, что отбор не «видит»
Немного математики в подтверждение того, что отбор не «видит»
Дырявое сито отбора …
Дырявое сито отбора …
Сравнительно-видовая экология
Сравнительно-видовая экология
Поскольку в популяциях крупных видов эффективность отбора ниже, можно
Поскольку в популяциях крупных видов эффективность отбора ниже, можно
Kr/Kc polarity
Kr/Kc polarity
Kr/Kc volume
Kr/Kc volume
Трудности сравнительно-видового анализа
Трудности сравнительно-видового анализа
Parame-ters Model
Parame-ters Model
Averages, standard errors, and parameters of ordinary linear and
Averages, standard errors, and parameters of ordinary linear and
?
?
Полезные мутации как осложняющее жизнь обстоятельство
Полезные мутации как осложняющее жизнь обстоятельство

Презентация: «Макроэкология (= сравнительно-видовая экология) популяционная генетика (и биоинформатика) =». Автор: Leonard. Файл: «Макроэкология (= сравнительно-видовая экология) популяционная генетика (и биоинформатика) =.ppt». Размер zip-архива: 982 КБ.

Макроэкология (= сравнительно-видовая экология) популяционная генетика (и биоинформатика) =

содержание презентации «Макроэкология (= сравнительно-видовая экология) популяционная генетика (и биоинформатика) =.ppt»
СлайдТекст
1 Макроэкология (= сравнительно-видовая экология) + популяционная

Макроэкология (= сравнительно-видовая экология) + популяционная

генетика (и биоинформатика) = ? Эволюционная макроэкология!

Nothing in biology makes sense except in the light of evolution (Theodosius Dobzhansky, 1973)

Nothing in evolution makes sense except in the light of population genetics (Mike Lynch, 2007)

2 Пять основных слагаемых процесса эволюции

Пять основных слагаемых процесса эволюции

Мутации

Рекомбинация

Миграции

Генетический дрейф

Отбор

Источники изменчивости

Способы закрепления изменчивости

Выделены те процессы, которые будут нас интересовать

3 Мутации, в конечном счете, единственный источник генетической

Мутации, в конечном счете, единственный источник генетической

изменчивости de novo. Однако благоприятных мутаций мало. Почти все мутации снижают приспособленность. Своего рода трэйд-офф … ?

Неблагоприятные мутации – летальные, вредные, слабовредные. Летальные и вредные с сильно выраженным эффектом отсекаются на индивидуальном уровне, в эволюции большой роли не играют, поскольку не могут быть переданы потомкам. Слабовредные, напротив, играют значительную роль в эволюции.

4 Геномные – изменение числа хромосом (например, полиплоидизация)

Геномные – изменение числа хромосом (например, полиплоидизация)

Хромосомные (делеция, дупликация, инверсия и транслокация) Нуклеотидные (точковые) – замены, делеции и вставки нуклеотидов

«Морфология» мутаций

Азотистые основания, входящие в ДНК и РНК

3

1

Аденин (A)

Гуанин (G)

Цитозин (C)

Тимин (T)

Урацил (T)

Два типа замен – транзиции и трансверсии Азотистые основания – пурины (аденин и гуанин) и пиримиды (цитозин, тимин и урацил) Транзиция – замена пурина на пурин и пиримидина на пиримидин Трансвесия – замена пурина на пиримидин и пиримидина на пурин

5 Источник: Wikipedia

Источник: Wikipedia

6 Классификация точковых мутаций «по смыслу»

Классификация точковых мутаций «по смыслу»

Несинонимические нуклеотидные замены, приводящие к замене аминокислоты, - это и есть мутации в узком смысле, темп накопления которых у данного вида мы хотим найти

Сохранение смысла кодона из-за вырожденности генетического кода (синонимическая замена нуклеотида) Изменение смысла кодона, приводящее к замене аминокислоты (несинонимическая замена нуклеотида) Образование бессмысленного кодона (нонсенс-мутация, или образование стоп-кодона) Мутация, обратная к 3), то есть замена стоп-кодона на смысловой кодон

Вырожденность генетического кода: 61 кодон кодирует 20 аминокислот

7 Таблица генетического кода: синонимические и несинонимические замены

Таблица генетического кода: синонимические и несинонимические замены

Вырожденность генетического кода неравномерна!

Схема с сайта: http://www.geneticsolutions.com/...530:1873

8 Как определяют темп накопления мутаций

Как определяют темп накопления мутаций

The GenBank sequence database is an open access, annotated collection of all publicly available nucleotide sequences and their protein translations. This database is produced at National Center for Biotechnology Information (NCBI) […]. GenBank and its collaborators receive sequences produced in laboratories throughout the world from more than 100,000 distinct organisms. GenBank continues to grow at an exponential rate, doubling every 18 months. Release 155, produced in August 2006, contained over 65 billion nucleotide bases in more than 61 million sequences. GenBank is built by direct submissions from individual laboratories, as well as from bulk submissions from large-scale sequencing centers. (Wikipedia)

Идем в GenBank http://www.ncbi.nlm.nih.gov/Genbank/ и извлекаем из него нужную нам нуклеотидную последовательность (например, полную последовательность митохондриального генома у данного вида)

9 Нуклеотидная последовательность для цитохрома b из GenBank (1140 bp)

Нуклеотидная последовательность для цитохрома b из GenBank (1140 bp)

>Desmana_moschata ATGACAAATATCCGAAAAACCCACCCCATTATAAAGATTATTAACGACTCTTTCATTGATTTACCAACACCATCAAACATTTCATCCTGATGAAATTTTGGTTCGCTCTTAGGGATTTGCTTAGTTATCCAAATTATCACAGGACTATTCCTCGCAATACACTACACACCAGACACCATAACAGCCTTCTCATCAGTAACCCACATCTGCCGAGACGTAAACTACGGCTGACTTATCCGATACCTTCATGCAAACGGGGCTTCCATATTTTTTATTTGTTTATTCCTACATGTAGGTCGAGGACTATATTATGGATCCTACATATTCACAGAAACTTGAAATATTGGAGTATTACTATTATTCGCCACTATAGCCACTGCATTCATAGGGTACGTTCTGCCATGGGGTCAAATATCCTTTTGAGGCGCAACGGTAATTACAAATTTATTGTCAGCCATTCCTTACATCGGAACAGACCTTGTAGAATGAATCTGAGGAGGTTTTTCAGTAGATAAAGCAACACTGACCCGATTTTTTGCTTTCCATTTTATTCTGCCATTCATTATTGCAGCTATGGCTGGCGTACATTTATTATTCCTTCATGAAACTGGTTCTAATAACCCTTCCGGACTGTTATCTGACGCTGACAAAATCCCATTCCACCCATATTATACCATTAAAGACACTCTAGGAGCCCTAGCCCTTATCACAGTATTATCCCTACTCGTATTATTTTCACCAGACCTATTAGGAGACCCAGACAACTATACTCCAGCCAACCCACTAAACACACCACCCCACATTAAACCAGAATGATACTTCCTATTCGCATACGCAATCCTACGTTCAATTCCTAACAAACTAGGAGGTGTTTTAGCTCTAGTTATATCTATTCTAGTCCTAGCACTAATACCATTCCTACATACCTCAAAACAACGAAGCATGATATTCCGACCTATTAGCCAATGCTTATTCTGATTACTAGTGGCCGACCTACTTGTATTAACATGAATTGGAGGCCAACCAGTAGAGCACCCTTTCATCATCATCGGCCAAGTAGCCTCAATCCTTTACTTCCTCTTAATCCTAGTATTAATACCACTGGCAAGCATTATAGAAAACAACTTACTCAAATGA

Фото: Нелли Зарипова Источник: http://www.biodiversity.ru/programs/vyhuh/gallery/photoalbum.html

10 Кольцевая ДНК митохондрий млекопитающих с указанным на ней цитохромом

Кольцевая ДНК митохондрий млекопитающих с указанным на ней цитохромом

Источник: http://herkules.oulu.fi/isbn9514255364/html/x128.html

Codon Table

11 Как определяют темп накопления мутаций (продолжение)

Как определяют темп накопления мутаций (продолжение)

Отношение (относительного) числа несинонимических замен к (относительному) числу синонимических замен есть мера темпа накопления мутаций (большинство из которых слабовредные).

Идем в GenBank и извлекаем из него нужную нам нуклеотидную последовательность Сравниваем нуклеотидные последовательности разных видов (sequence alignment, или выравнивание), то есть записываем их одну под другой, чтобы было как можно больше совпадений, например

Вид 1

T

g

t

A

C

c

T

C

g

T

g

G

-

A

A

-

-

Вид 2

T

-

-

A

C

-

T

C

a

T

a

G

c

A

A

c

c

На основании сравнения строим филогенетическое дерево (исходя из того, что близкие виды имеют сходные последовательности). В концевых точках этого дерева находятся современные виды, а в ближайших узлах – их общие предки (т.е. реконструированные последовательности) Сравниваем последовательности современных видов и их ближайших предков, выделяем триплеты нуклеотидов, среди них находим различающиеся, а среди различающихся – триплеты с синонимическими заменами и триплеты с несинонимическими заменами

12 От (неблагоприятных) мутаций до вымирания …

От (неблагоприятных) мутаций до вымирания …

Отбор

Дрейф

Неблагоприятные мутации

Генетический груз

«Объем» мутаций подпитывается новыми мутациями, сокращается «очищающим» отбором и поддерживается генетическим дрейфом

Вымирание

13 Генетический дрейф – роль случайности в эволюции

Генетический дрейф – роль случайности в эволюции

Поколение n

Поколение n+1

За счет дрейфа вероятность сохранения редкого мутантного аллеля в следующем поколении 0.63

Генетический дрейф – это фиксация возникающих мутаций не за счет отбора, а по воле случая. Генетический дрейф отражает влияние случайного выбора (не отбора!) на возможность сохранения или утраты мутантного аллеля в ряду поколений

Вероятность утраты мутантного аллеля в поколении n+1

Доля мутантного аллеля в поколении n

Факт из математики

Источник: Amos Tanay, Weizmann Institute of Science, Genome evolution: a sequence-centric approach, Lecture 8-9 (2008), с изменениями

14 Отбор

Отбор

Дрейф

Соотношение между отбором и дрейфом зависит от численности

Высокая численность

Низкая численность

Отбор неэффективен в популяциях с низкой численностью, а дрейф – наоборот (population bottleneck – популяционное узкое место, феномен «бутылочного горлышка»)

Чем ниже численность, тем менее эффективен отбор и более эффективен дрейф

15 Мутационное «таяние» популяции (mutational meltdown)

Мутационное «таяние» популяции (mutational meltdown)

N1

Воронка снижаю щейся числ енн ос т и

Низкая численность

Сильный дрейф

Больше генетический груз

Ниже рождаемость и выше смертность

N2

Положительная обратная связь между низкой численностью, сильным дрейфом и накоплением мутаций

16 Вероятность фиксации нейтральной мутации (s = 0)

Вероятность фиксации нейтральной мутации (s = 0)

Поколение n

Поколение n+1

Вероятность фиксации нейтрального мутантного аллеля через много поколений

Вероятность утраты мутантного аллеля в поколении n+1

Доля мутантного аллеля в поколении n

Просто потому что все аллели равноправны, и один из них должен быть в конце концов зафиксирован (потому что на каждом шаге – т.е. в каждом следующем поколении – есть вероятность утраты аллеля и в конце концов все они будут утрачены, кроме одного)

17 Вероятность фиксации мутации (общий случай)

Вероятность фиксации мутации (общий случай)

U – вероятность фиксации p – начальная частота мутантного аллеля s – сила отбора (селективное преимущество мутантного аллеля при s > 0 или коэффициент отбора при s < 0; 1+s – приспособленность мутантного аллеля) ne – эффективная численность популяции (эффективная численность аллеля)

Что такое селективное преимущество s? Скорость роста частоты аллеля p описывается уравнением (Kimura, 1962) : ?p = sp(1-p), которое является аналогом логистического уравнения, поэтому s – удельная скорость изменения численности аллеля при p << 1 (аналог r). Если p мало, то ?p = sp и p2 = (1+s)p1, соответственно 1+s – коэффициент роста численности аллеля. Что такое эффективная численность Ne? «The effective size of a population is the size of an ideal population that has the same properties with respect to genetic drift as our actual population does.» (Kent Holsinger, University of Connecticut)

18 Варианты базовой формулы для вероятности фиксации

Варианты базовой формулы для вероятности фиксации

19 Вероятность фиксации мутации в зависимости от s и Ne

Вероятность фиксации мутации в зависимости от s и Ne

При низкой численности вероятность фиксации почти одинакова для вредных и полезных мутаций – отбор не «видит» слабовредных мутаций!!!

20 Немного математики в подтверждение того, что отбор не «видит»

Немного математики в подтверждение того, что отбор не «видит»

слабовредных мутаций

Слабовредная (или слабополезная) мутация при низкой численности: |sNe| < 1

Нейтральная мутация s = 0

Раскрываем неопределенность при s = 0

Разлагаем экспоненту в ряд

Вероятность фиксации нейтральной мутации

Вероятность фиксации такая же, как у нейтральной мутации!

21 Дырявое сито отбора …

Дырявое сито отбора …

|s| < 1/Ne Популяции A и B Ne(A) > Ne(B) (1) Отбор пропускает («не видит») более вредные мутации в популяции B, чем в A (2) Отбор пропускает больше вредных мутаций в популяции B (3) Отбор более эффективен в A, чем в B (4) «Ячея сита отбора в популяции A гуще»

Эффективность отбора зависит от численности популяции: В малочисленных популяциях эффективность отбора ниже

Плотность вероятности коэффициента s новой мутации

Автор рисунка К.Ю. Попадьин

Ячея сита отбора в популяции A

Ячея сита отбора в популяции B

22 Сравнительно-видовая экология

Сравнительно-видовая экология

|s| < 1/Ne A – мелкий вид, B – крупный вид Ne(A) > Ne(B) (1) Отбор пропускает («не видит») более вредные мутации у крупного вида (2) Отбор пропускает больше вредных мутаций у крупного вида

Эффективность отбора зависит от численности популяции: В популяциях крупных видов эффективность отбора ниже

Плотность вероятности коэффициента s новой мутации

Автор рисунка К.Ю. Попадьин

Ячея сита отбора у мелкого вида

Ячея сита отбора у крупного вида

23 Поскольку в популяциях крупных видов эффективность отбора ниже, можно

Поскольку в популяциях крупных видов эффективность отбора ниже, можно

предположить, что темп накопления мутаций у них выше Для проверки этого предположения были проанализированы полные митохондриальные геномы у 110 видов млекопитающих

24 Kr/Kc polarity

Kr/Kc polarity

Kr/Kc volume

Ka/Ks

Kr/Kc polarity-volume

Kr/Kc charge

Grantham distance

Comparison of averages of six molecular traits for 55 small (ln W < 9.04) and 55 large (ln W > 9.04) mammals where 9.04 is the median of loge transformed body mass W (in grams)

Popadin K., Polishchuk L.V., Mamirova L., Knorre D., and Gunbin K. 2007. Accumulation of slightly deleterious mutations in mitochondrial protein-coding genes of large versus small mammals. PNAS 104: 13390-13395

©2007 by National Academy of Sciences

25 Kr/Kc volume

Kr/Kc volume

Ka/Ks

Kr/Kc polarity

Grantham distance

Kr/Kc polarity-volume

Kr/Kc charge

The ordinary linear regressions of molecular traits on loge body mass W for 110 mammalian species

Popadin K., Polishchuk L.V., Mamirova L., Knorre D., and Gunbin K. 2007. Accumulation of slightly deleterious mutations in mitochondrial protein-coding genes of large versus small mammals. PNAS 104: 13390-13395

©2007 by National Academy of Sciences

26 Трудности сравнительно-видового анализа

Трудности сравнительно-видового анализа

Статистическая не-независимость данных, относящихся к отдельным видам, является следствием их родства

Источник: Felsenstein J. 1985. Phylogenies and the comparative method. Am. Nat. 125: 1-15

27 Parame-ters Model

Parame-ters Model

Parame-ters Model

Ka/Ks

Ka/Ks

Kr/Kc based on

Kr/Kc based on

Kr/Kc based on

Kr/Kc based on

OLM

MEM

Ratios of nonsynonymous to synonymous (Ka/Ks) and of radical to conservative (Kr/Kc) substitution rates, and amino acid dissimilarity between modern species and their most recent reconstructed ancestors measured in terms of Grantham's distance for large versus small mammals. The values are calculated from ordinary linear models (OLM) and mixed-effects models (MEM).

Значения характеризуют типичный крупный вид (369.5 кг, выделено красным) и типичный мелкий вид (275 г, выделено синим) в нашей выборке

Grantham distance

Grantham distance

Polarity

Volume

Polarity-Volume

Charge

0.054 0.039

0.97 0.72

1.01 0.74

0.53 0.48

0.45 0.38

58.63 55.25

0.054 0.036

0.95 0.68

0.98 0.74

0.52 0.48

0.44 0.39

58.45 55.00

28 Averages, standard errors, and parameters of ordinary linear and

Averages, standard errors, and parameters of ordinary linear and

mixed-effects regressions on loge body mass along with associated P values for each trait under study

Trait

Trait

Ordinary linear models

Ordinary linear models

Ordinary linear models

Mixed-effects models

Mixed-effects models

Mixed-effects models

Average (SE)

Average (SE)

Intercept

Slope

P

Intercept

Slope

P

0.046 (0.002)

0.028

0.0020

<0.001

0.023

0.0024

0.010

0.846 (0.028)

0.525

0.0348

<0.001

0.475

0.0369

0.002

0.872 (0.027)

0.528

0.0373

<0.001

0.547

0.0337

0.001

0.504 (0.012)

0.443

0.0066

0.013

0.449

0.0057

0.061

0.420 (0.016)

0.330

0.0097

0.007

0.353

0.0066

0.157

56.940 (0.462)

52.614

0.4692

<0.001

52.314

0.4784

0.001

Calculations are based on 110 mammalian species. SE, standard error.

Ka/Ks

Polarity-based Kr/Kc

Volume-based Kr/Kc

Polarity-volume-based Kr/Kc

Charge-based Kr/Kc

Grantham distance

29 ?

?

?

Может ли повышенный темп накопления мутаций у крупных видов быть причиной их преимущественного вымирания?

Для ответа на этот вопрос надо построить зависимость вероятности оказаться под угрозой вымирания (т.е. вероятности попасть в Красную книгу) от темпа накопления мутаций. Однако интерпретация этой зависимости осложняется тем, что и вероятность оказаться под угрозой вымирания, и темп накопления мутаций зависят от численности.

Ka/Ks

Вымирание

Ka/Ks

Вымирание

N

W

Необходимо установить, есть ли связь между Ka/Ks и вымиранием при постоянстве N или при постоянстве W

30 Полезные мутации как осложняющее жизнь обстоятельство

Полезные мутации как осложняющее жизнь обстоятельство

Поскольку речь идет о вымирании, нас интересуют здесь только не-благоприятные мутации. Таких действительно большинство. Тем не менее не все мутации неблагоприятные (например, возникновение устойчивости к антибиотикам – мутация, полезная для бактерий)

Кроме того, при изменении условий мутация исходно вредная может оказаться полезной. Классический пример мутации превращения вредной мутации в полезную – меланизм березовой пяденицы (Biston betularia)

Пятнистая и темная формы березовой пяденицы на стволе, покрытом лишайником (слева), и на темном стволе без лишайников

Источник: http://bill.srnr.arizona.edu/classes/182/Melanism/Kettlewell.htm

«Макроэкология (= сравнительно-видовая экология) популяционная генетика (и биоинформатика) =»
http://900igr.net/prezentacija/biologija/makroekologija-sravnitelno-vidovaja-ekologija-populjatsionnaja-genetika-i-bioinformatika-189349.html
cсылка на страницу
Урок

Биология

136 тем
Слайды
900igr.net > Презентации по биологии > Генетика > Макроэкология (= сравнительно-видовая экология) популяционная генетика (и биоинформатика) =