Мутация
<<  Виды изменчивости и виды мутаций у человека Генетическая вариабельность диких и вакцинных штаммов вируса кори  >>
Лекция 7 Взаимодействие геномов клетки Мутации пластидной и
Лекция 7 Взаимодействие геномов клетки Мутации пластидной и
Типы генов в органеллах и у свободноживущих предшественников
Типы генов в органеллах и у свободноживущих предшественников
I - Ядерные гены участвуют в образовании и жизнедеятельности органелл:
I - Ядерные гены участвуют в образовании и жизнедеятельности органелл:
ND 7 – 35
ND 7 – 35
Развитие хлоропластов из пропластид происходит под воздействием
Развитие хлоропластов из пропластид происходит под воздействием
Cхема биогенеза пластид и ядерно-хлоропластного взаимодействия геномов
Cхема биогенеза пластид и ядерно-хлоропластного взаимодействия геномов
Ядерные "фотогены" – гены, экспрессия которых зависит от света
Ядерные "фотогены" – гены, экспрессия которых зависит от света
Регулирующая роль ядерных генов в функционировании пластид является
Регулирующая роль ядерных генов в функционировании пластид является
Влияние пластид на экспрессию генов ядра
Влияние пластид на экспрессию генов ядра
В некоторых случаях пластидный сигнал может регулировать экспрессию
В некоторых случаях пластидный сигнал может регулировать экспрессию
Природа регуляторных сигналов пока не известна, однако очевидно, что
Природа регуляторных сигналов пока не известна, однако очевидно, что
Наиболее детально процесс взаимодействия геномов ядра и митохондрий
Наиболее детально процесс взаимодействия геномов ядра и митохондрий
Ретроградная регуляция:
Ретроградная регуляция:
1 2 3 4
1 2 3 4
При митохондриальных дисфункциях экспрессия СIT1 не меняется, а СIT2
При митохондриальных дисфункциях экспрессия СIT1 не меняется, а СIT2
Самая сложная внутриклеточная регуляция экспрессии генов у растений –
Самая сложная внутриклеточная регуляция экспрессии генов у растений –
Механизмы внутриклеточного распределения продуктов ядерных генов
Механизмы внутриклеточного распределения продуктов ядерных генов
Регуляторные механизмы локализации белков внутри клетки
Регуляторные механизмы локализации белков внутри клетки
Cпонтанные мутации органельных геномов
Cпонтанные мутации органельных геномов
Пестролистность в основном изучалась у родов Antirrhinum и Oenothera
Пестролистность в основном изучалась у родов Antirrhinum и Oenothera
Пестролистные формы получены для самых разных декоративных видов
Пестролистные формы получены для самых разных декоративных видов
Пластидные мутации по своему фенотипическому проявлению делятся на три
Пластидные мутации по своему фенотипическому проявлению делятся на три
Одноклеточная зеленая водоросль Chlamydomonas -классический объект для
Одноклеточная зеленая водоросль Chlamydomonas -классический объект для
Митохондриальные мутации интенсивно изучались на культурах дрожжей,
Митохондриальные мутации интенсивно изучались на культурах дрожжей,
Ядерная ДНК млекопитающих
Ядерная ДНК млекопитающих
Митохондриальная ДНК покрытосеменных – самая стабильная часть
Митохондриальная ДНК покрытосеменных – самая стабильная часть
Является ли этот феномен результатом более низкой частоты мутирования
Является ли этот феномен результатом более низкой частоты мутирования
Почему митохондриальные ДНК высших растений имеют необычно низкий
Почему митохондриальные ДНК высших растений имеют необычно низкий
Из 281 проанализированных видов покрытосеменных у двух – Pelargonium
Из 281 проанализированных видов покрытосеменных у двух – Pelargonium
Структурные перестройки генома
Структурные перестройки генома
В целом, хлоропластный геном эволюционирует по принципу «используй или
В целом, хлоропластный геном эволюционирует по принципу «используй или
Мито - склад неиспользуемых последовательностей
Мито - склад неиспользуемых последовательностей
Горячие точки при структурных реорганизациях органельных геномов
Горячие точки при структурных реорганизациях органельных геномов
В митохондриальных геномах самых разных организмов, начиная от дрожжей
В митохондриальных геномах самых разных организмов, начиная от дрожжей
Прямой повтор длиной 13 пар нуклеотидов причинно связан с
Прямой повтор длиной 13 пар нуклеотидов причинно связан с
Индуцированные мутации органельных геномов
Индуцированные мутации органельных геномов
Индукция органельных мутаций химическими мутагенами
Индукция органельных мутаций химическими мутагенами
Chlorina подсолнечника
Chlorina подсолнечника
Реорганизация хлоропластной ДНК у мутантов подсолнечника,
Реорганизация хлоропластной ДНК у мутантов подсолнечника,
Мутации органельных геномов, индуцированные ядерными генами-мутаторами
Мутации органельных геномов, индуцированные ядерными генами-мутаторами
Лекция 7 Взаимодействие геномов клетки Мутации пластидной и
Лекция 7 Взаимодействие геномов клетки Мутации пластидной и
Ядро
Ядро
Механизм действия генов-мутаторов окончательно не выяснен
Механизм действия генов-мутаторов окончательно не выяснен
Ген chm арабидопсиса, вызывает наследственные изменения не только в
Ген chm арабидопсиса, вызывает наследственные изменения не только в
Мутации хлоропластных ДНК при культивировании тканей in vitro
Мутации хлоропластных ДНК при культивировании тканей in vitro
Мутации ДНК хлоропластов и митохондрий претерпевают особенно долгий
Мутации ДНК хлоропластов и митохондрий претерпевают особенно долгий
На сегодня хватит
На сегодня хватит

Презентация: «Перестройки генома в онтогенезе». Автор: Danilenko. Файл: «Перестройки генома в онтогенезе.ppt». Размер zip-архива: 2242 КБ.

Перестройки генома в онтогенезе

содержание презентации «Перестройки генома в онтогенезе.ppt»
СлайдТекст
1 Лекция 7 Взаимодействие геномов клетки Мутации пластидной и

Лекция 7 Взаимодействие геномов клетки Мутации пластидной и

митохондриальной ДНК

1. Участие генов ядра в репликации и экспрессии пластидной ДНК Р Ретроградная регуляция 2. 3. Механизмы внутриклеточного распределения продуктов ядерных генов 4. Спонтанные мутации органельных геномов И Индуцированные мутации органельной ДНК М Мутации, вызванные ядерными генами-мутаторами 5. Культивирование растений in vitro и мутации

2 Типы генов в органеллах и у свободноживущих предшественников

Типы генов в органеллах и у свободноживущих предшественников

Synechocystis

Пластиды

Rickettsia

Митохондрии

Число генов в геноме

Фотосинтез и дыхание

Трансляция

Биосинтез кофакторов

Биосинтез аминокислот

Клеточные процессы

Транспорт.и пермеазы

Метаболизм липидов

Транскрипция

Регулят. функции

Энерг. метаболизм

Биосинтез нуклеотидов

Репликация и репарация ДНК

160

140

120

100

80

60

40

20

0

3 I - Ядерные гены участвуют в образовании и жизнедеятельности органелл:

I - Ядерные гены участвуют в образовании и жизнедеятельности органелл:

Взаимодействие ядерного и органельного геномов – на каждом этапе развития органелл

репликация ДНК органелл осуществляется ферментами ядерного кодирования и специальными белковыми факторами; транскрипция и трансляция осуществляется в большинстве случаев ферментами ядерного кодирования и специальными белковыми факторами ; процессинг, сплайсинг, РНК-редактирование органельных генов выполняют в основном ферменты ядерного кодирования.

4 ND 7 – 35

ND 7 – 35

RbcL – хпДНК

COB 1 – 10

RbcS - яДНК

COX 3 – 10

ATP 2 – 14

РНК и белки рибосом – совместное кодирование у всех эукариот

мтДНК яДНК

II . Ядерные геномы совместно с органельными кодируют субъединицы белков либо отдельных белков сложных многокомпонентных комплексов:

Пластиды высших растений

Мт животных

Самые яркие примеры

5 Развитие хлоропластов из пропластид происходит под воздействием

Развитие хлоропластов из пропластид происходит под воздействием

внешних сигналов

Свет

Координированная экспрессия ядерных и пластидных генов

6 Cхема биогенеза пластид и ядерно-хлоропластного взаимодействия геномов

Cхема биогенеза пластид и ядерно-хлоропластного взаимодействия геномов

7 Ядерные "фотогены" – гены, экспрессия которых зависит от света

Ядерные "фотогены" – гены, экспрессия которых зависит от света

Контролируют в основном компоненты фотосинтетического аппарата

При освещении экспрессия их возрастает в 100 и более раз

Мутанты gun (genome uncoupled) c нарушенной ядерно-пластидной координацией экспрессируют ряд ядерных фотогенов в условиях, когда развитие пластид подавлено

При отсутствии света либо полностью блокированы, либо экспрессируются на очень низком уровне

8 Регулирующая роль ядерных генов в функционировании пластид является

Регулирующая роль ядерных генов в функционировании пластид является

бесспорной. Верно ли обратное – зависит ли экспрессия ядерных генов от процессов, происходящих в пластидах?

Гипотеза:

Пластиды индуцируют какой-то сигнал, необходимый для экспрессии фотосинтетических генов ядра

Что это за сигнал?

9 Влияние пластид на экспрессию генов ядра

Влияние пластид на экспрессию генов ядра

Вероятно, пластидный сигнал формируется с участием какого-то продукта ранней экспрессии пластидного генома (до 48-72 часов от начала прорастания)

Норфлуразон (фотодеструкция хп)

Хлорамфеникол (трансляция)

Тагетитоксин (транскрипция)

Эффект отмечен только при воздействии до 48 часов от начала прорастания

Вещества-ингибиторы

Снижение транскрипции ряда генов ядра (rbcS и др.)

10 В некоторых случаях пластидный сигнал может регулировать экспрессию

В некоторых случаях пластидный сигнал может регулировать экспрессию

ядерных генов и в отсутствие света

Существуют множественные сигнальные пути от хлоропластов к ядру

Показано, что экспрессия одних генов ядра растений в большей степени изменяется при повреждении пластид по сравнению с другими генами

11 Природа регуляторных сигналов пока не известна, однако очевидно, что

Природа регуляторных сигналов пока не известна, однако очевидно, что

они воспринимаются

Гено-специфичными элементами промоторов ядерных генов

Ядерный ген N

5‘ UTR

Пластидный сигнал 2

Пластидный сигнал 1

12 Наиболее детально процесс взаимодействия геномов ядра и митохондрий

Наиболее детально процесс взаимодействия геномов ядра и митохондрий

изучен у дрожжей

Специфические белки – активаторы трансляции митохондриальных генов, взаимодействуют с 5‘- UTR областями митохондриальных транскриптов

Активаторы выявлены практически для всех мт генов они могут регулироваться внешними факторами, что позволяет адаптировать трансляцию к изменяющимся условиям среды

13 Ретроградная регуляция:

Ретроградная регуляция:

Ядро

Функциональное состояние митохондрий влияет на экспрессию ядерного генома

Мт

При этом нужно учитывать, что

Количество белков, импортируемых в митохондрии из цитозоля для нормального функционирования клетки – до 4 тысяч

14 1 2 3 4

1 2 3 4

Экспрессия одних ядерных генов различается между мутантными штаммами

Экспрессия других ядерных генов не зависит от изменений в мтДНК

4 штамма дрожжей с одинаковым ядерным геномом, но с разным состоянием генома митохондрий

Мт геном потерян

Делеция в 1 гене

Полноценный мт геном

Сохранилось 700пн от всего мт генома

15 При митохондриальных дисфункциях экспрессия СIT1 не меняется, а СIT2

При митохондриальных дисфункциях экспрессия СIT1 не меняется, а СIT2

увеличивается в 30-40 раз. Данная регуляция осуществляется с помощью специальных генов группы RTG.

Изменение экспрессии гена цитратсинтазы СIT2 дрожжей - самый изученный пример ретроградной регуляции

Сit2

75%-ое сходство

Mit СIT

Сit1

СIT1 и СIT2

Древний ген в мт

Перенос гена в ядро

Дупликация гена в ядре

16 Самая сложная внутриклеточная регуляция экспрессии генов у растений –

Самая сложная внутриклеточная регуляция экспрессии генов у растений –

3 генома; У двух видов растений: арабидопсиса и бобов - идентифицировали ядерные гены, контролирующие число копий митохондриальной ДНК в клетке; Механизмы ядерно-плазменного взаимодействия - множественные, на всех уровнях экспрессии генома

Несмотря на ряд интересных фактов, понимание взаимодействия геномов клетки у растений находится пока на зачаточном состоянии.

17 Механизмы внутриклеточного распределения продуктов ядерных генов

Механизмы внутриклеточного распределения продуктов ядерных генов

Как направляются в митохондрии такие белки?

Более 90% мт белков кодируется ядром и транслируется на цитоплазматических рибосомах

При этом ряд мт белков не имеет в ядре собственных генов, а транскрибируется с тех же матриц, что и цитоплазматические белки

18 Регуляторные механизмы локализации белков внутри клетки

Регуляторные механизмы локализации белков внутри клетки

Первый способ регуляции – более универсальный

При транскрипции гена тРНК-синтетазы образуются две мРНК различной длины

С одной мРНК молекулы – два белка, т.к. два инициирующих кодона

Митохондриальный HTS

Цитоплазматический HTS

Различаются дополнительной последовательностью на 5’ конце – митохондриальный сигнал

Митохондриальный белок Mod5

Ядерный белок Mod5

A.

5’

5’

3’

B.

3’

5’

HTS

3’

MOD5

UTR

AUG(+61)

AUG(+1)

UTR.

AUG(+1)

AUG(+31)

19 Cпонтанные мутации органельных геномов

Cпонтанные мутации органельных геномов

Были обнаружены раньше, чем появилась наука о нехромосомной наследственности

Пестролистность – первые описанные спонтанные мутации пластома

Цитоплазматическая стерильность пыльцы – первые описанные спонтанные мутации митохондриального генома

20 Пестролистность в основном изучалась у родов Antirrhinum и Oenothera

Пестролистность в основном изучалась у родов Antirrhinum и Oenothera

Пестролистные растения в популяции Oenothera появлялись примерно с частотой ~ 0,3% Частота спонтанных мутаций хлорофилл-дефектности в пластоме колеблется у разных видов и составляет в среднем 0.01-1.3%

21 Пестролистные формы получены для самых разных декоративных видов

Пестролистные формы получены для самых разных декоративных видов

растений

22 Пластидные мутации по своему фенотипическому проявлению делятся на три

Пластидные мутации по своему фенотипическому проявлению делятся на три

основные группы: c нарушениями в световой и темновой фазах фотосинтеза и/или дефектной окраской листьев – от светло-зеленых до белых; с приобретенной резистентностью к гербицидам; с приобретенной резистентностью к антибиотикам

23 Одноклеточная зеленая водоросль Chlamydomonas -классический объект для

Одноклеточная зеленая водоросль Chlamydomonas -классический объект для

изучения пластидных мутаций в 50-60ые годы

В хлоропластах четырех видов Сhlamydomonas было обнаружено большее разнообразие геномных перестроек, чем описано для более чем 200 видов наземных растений

Рут Сэджер – автор классических работ по хлоропластной генетике Сhlamydomonas

C. reinhardtii, C. smithii, C. eugametos, C. moewusii

24 Митохондриальные мутации интенсивно изучались на культурах дрожжей,

Митохондриальные мутации интенсивно изучались на культурах дрожжей,

нейроспоры и других грибов

Были обнаружены несколько классов мутаций: плейотропные мутации - к ним относятся petite – мутации дыхательной недостаточности, а также мутации mit,- имеющие фенотип petite, но сохранившие систему митохондриального белкового синтеза мутации антибиотикоустойчивости

25 Ядерная ДНК млекопитающих

Ядерная ДНК млекопитающих

Ядерная ДНК высших растений

митохондриальная ДНК высших растений

митохондриальная ДНК млекопитающих

Примерно одинакова

~ ~

В 50-100 раз выше, чем у растений

26 Митохондриальная ДНК покрытосеменных – самая стабильная часть

Митохондриальная ДНК покрытосеменных – самая стабильная часть

клеточного генома

Мт хп я

Ядерные ДНК покрытосеменных изменяются в 2 раза быстрее, чем хлоропластные, а хлоропластные в 3 раза быстрее, чем митохондриальные ДНК.

Частота точечных мутаций

27 Является ли этот феномен результатом более низкой частоты мутирования

Является ли этот феномен результатом более низкой частоты мутирования

или следствием более эффективной репарации возникших замен с сохранением абсолютной идентичности обеих копий?

Пока неясно

Большие инвертированные повторы хлоропластной ДНК отличаются повышенной стабильностью

Частота нуклеотидных замен в этих районах по крайней мере в три-четыре раза ниже, чем в остальных

28 Почему митохондриальные ДНК высших растений имеют необычно низкий

Почему митохондриальные ДНК высших растений имеют необычно низкий

уровень точковых мутаций ?

Высокая репарационная активность?

Высокая точность ДНК-полимеразы?

Ответа пока нет

29 Из 281 проанализированных видов покрытосеменных у двух – Pelargonium

Из 281 проанализированных видов покрытосеменных у двух – Pelargonium

hortorum и Plantago rugelii уровень спонтанных мутаций мтДНК оказался в десятки раз выше, чем у всех остальных, приближаясь к таковому в мтДНК позвоночных.

??? ! ! !

Хлоропластные ДНК этих двух видов практически не отличаются от других по уровню спонтанных мутаций, так что эти виды нельзя отнести к быстро эволюционирующим

30 Структурные перестройки генома

Структурные перестройки генома

Митохондрии

Хлоропласты

В то время как митохондриальные ДНК высших растений отличаются значительной вариабельностью размеров и структуры молекул, порядок генов в хлоропластной ДНК высших растений почти не изменялся. Так, Marchantia, отделенная от табака по крайней мере 400 миллионами лет эволюции, имеет всего одну инверсию в хлоропластном геноме. Три инверсии отличают хпДНК табака от хпДНК риса (рис.9.1). В то же время, митохондриальный геном двух различных цитоплазм (Т и N) кукурузы, разделенных не более 100 тыс. лет эволюции, различается не менее чем 30 перестройками [Palmer, 1990].

Вариабельность размеров и структуры молекул

Порядок генов в хлоропластной ДНК высших растений почти не изменялся

Nicotiana

Marchantia

Три инверсии отличают хпДНК табака от хпДНК риса

400 млн лет эволюции

Одна инверсия в хлоропластном геноме

31 В целом, хлоропластный геном эволюционирует по принципу «используй или

В целом, хлоропластный геном эволюционирует по принципу «используй или

избавляйся» “use it or loose it”

Утрата половины пластидного генома бесцветной эвгленоидной водорослью Astasia longa

Малое количество псевдогенов, утрата фотосинтетических генов растениями - паразитами

32 Мито - склад неиспользуемых последовательностей

Мито - склад неиспользуемых последовательностей

В митохондриях Epiphagus сохраняются ряд фотосинтетических генов пластидного происхождения

В то же время в самих пластидах Epiphagus эти гены элиминируются

33 Горячие точки при структурных реорганизациях органельных геномов

Горячие точки при структурных реорганизациях органельных геномов

Сравнение структурных мутаций у родственных видов и родов растений показывает, что чаще всего они происходят в определенных местах – так называемых горячих точках (hot spot)

Природа горячих точек не выяснена

???

Возможной причиной горячих точек в хлоропластном геноме являются АТ- богатые области ДНК молекулы

Возможно, они связаны с наличием коротких повторяющихся последовательностей

34 В митохондриальных геномах самых разных организмов, начиная от дрожжей

В митохондриальных геномах самых разных организмов, начиная от дрожжей

и кончая высшими эукариотами, в т.ч. человеком, обнаруживаются крупные делеции

Эти мутации существуют обычно в гетероплазматическом состоянии

Горячие точки при возникновении этих делеций связывают (как и для хлоропластной ДНК) с повторами в митохондриальном геноме

35 Прямой повтор длиной 13 пар нуклеотидов причинно связан с

Прямой повтор длиной 13 пар нуклеотидов причинно связан с

возникновением крупной (5 т.п.н.) делеции в митохондриальной ДНК человека

Но! Три из четырех 13-нуклеотидных повторов не связаны ни с какими крупными делециями

13 п.О.

Ааgcccataaaaataaaaattataacaaaccctgaga…………..Actcaaaaccatacctctcacttcaacctccctcacca

L K M L N T N Y H L P P S P L A A *

36 Индуцированные мутации органельных геномов

Индуцированные мутации органельных геномов

Цель индуцирования мутаций органелл:

Понять, как устроены и как экспрессируются органельные геномы

Попытаться решить ряд прагматических задач

Урожайность

Синтез определенных необходимых человеку веществ

Устойчивость к разным стрессам

37 Индукция органельных мутаций химическими мутагенами

Индукция органельных мутаций химическими мутагенами

Использовали:

интеркалирующие в ДНК флуоресцентные красители

Антибиотики

Нитрозосоединения

N-нитрозо-N-метил-мочевина (НММ) и N-нитрозо-N-этил-мочевина (НЭМ)

Бромистый этидий и акридины

Оказались наиболее эффективными

38 Chlorina подсолнечника

Chlorina подсолнечника

мтДНК нейроспора

???

NO O ? ? CH3—N—C—NH2

Мт ДНК крыс

Мт ДНК дрожжей

39 Реорганизация хлоропластной ДНК у мутантов подсолнечника,

Реорганизация хлоропластной ДНК у мутантов подсолнечника,

индуцированных нитрозо-метил мочевиной (рестриктный анализ с эндонуклеазой HindIII)

?/Pst ?/HindIII chl1 chl2 chl3 chl5 chl6 chl7 N chl8 chl9 chl10 chl11 chl12 N

40 Мутации органельных геномов, индуцированные ядерными генами-мутаторами

Мутации органельных геномов, индуцированные ядерными генами-мутаторами

У разных видов растений описаны природные изоляты, в которых частота пластомных мутаций в сотни и даже тысячи раз превышает спонтанный уровень

Причина: рецессивные ядерные гены, названные генами-мутаторами

41 Лекция 7 Взаимодействие геномов клетки Мутации пластидной и
42 Ядро

Ядро

В гомозиготном состоянии гены-мутаторы вызывают дестабилизацию хлоропластного генома

Возникшие пластидные мутации далее наследуются по материнскому типу и уже не зависят от генотипа ядра

Мутабильность ядерных генов у растений -носителей генов-мутаторов не повышается

43 Механизм действия генов-мутаторов окончательно не выяснен

Механизм действия генов-мутаторов окончательно не выяснен

Очевидно, происходит нарушение какого-то компонента системы репликации - репарации пластид, кодируемого ядром

44 Ген chm арабидопсиса, вызывает наследственные изменения не только в

Ген chm арабидопсиса, вызывает наследственные изменения не только в

пластидах (пестролистность) но и в митохондриях

Предположение:

Наблюдаемые аномальные митохондриальные фрагменты предсуществовали у растений дикого типа, а гены-мутаторы способствовали их амплификации и вытеснению нормальных молекул

45 Мутации хлоропластных ДНК при культивировании тканей in vitro

Мутации хлоропластных ДНК при культивировании тканей in vitro

Культура пыльников растений широко используется для получения гаплоидных растений

Хлоропластная ДНК таких альбиносов имеет огромные делеции, иногда до 80% всей молекулы

Условия культивирования каким-то непонятным пока образом провоцируют эти мутации, почему-то именно у злаков

Но у злаков – регенерантов из пыльников очень большая доля альбиносных растений в культуре ( иногда до 80-100%)

46 Мутации ДНК хлоропластов и митохондрий претерпевают особенно долгий

Мутации ДНК хлоропластов и митохондрий претерпевают особенно долгий

путь сегрегации, последовательно

На уровне:

Многие возникающие мутации элиминируются на этом пути

Органеллы

Клетки

Целого организма

47 На сегодня хватит

На сегодня хватит

«Перестройки генома в онтогенезе»
http://900igr.net/prezentacija/biologija/perestrojki-genoma-v-ontogeneze-187339.html
cсылка на страницу

Мутация

6 презентаций о мутации
Урок

Биология

136 тем
Слайды
900igr.net > Презентации по биологии > Мутация > Перестройки генома в онтогенезе