Экология
<<  Общая экология Основы экологии  >>
Общая экология
Общая экология
Объем экологии (в прямом и переносном смысле слова)
Объем экологии (в прямом и переносном смысле слова)
Как устроена экология, или чем отличается зрелая наука от незрелой
Как устроена экология, или чем отличается зрелая наука от незрелой
Идеал количественной науки
Идеал количественной науки
Определение экологии, или многое ли мы узнаём из определения науки
Определение экологии, или многое ли мы узнаём из определения науки
Как на этом фоне обстоит дело с определением экологии
Как на этом фоне обстоит дело с определением экологии
Экология как разномасштабная наука
Экология как разномасштабная наука
Эта схема не отрицает возможности создания теории экологических
Эта схема не отрицает возможности создания теории экологических
Универсальный инструмент – что это
Универсальный инструмент – что это
Содержание лекции: Две экологические задачи
Содержание лекции: Две экологические задачи
Пример на тему популяционного анализа: Как оценивают рождаемость
Пример на тему популяционного анализа: Как оценивают рождаемость
Два основных эффекта – top-down и bottom-up
Два основных эффекта – top-down и bottom-up
Размерно-избирательная элиминация планктонных рачков рыбами
Размерно-избирательная элиминация планктонных рачков рыбами
b = V ln(1 + FA) Демографические показатели, влияющие на b: V = 1/De –
b = V ln(1 + FA) Демографические показатели, влияющие на b: V = 1/De –
ВЛИЯНИЕ СРЕДЫ НА РОЖДАЕМОСТЬ b опосредовано скоростью развития яиц V,
ВЛИЯНИЕ СРЕДЫ НА РОЖДАЕМОСТЬ b опосредовано скоростью развития яиц V,
Оценка роли V, F и A с помощью метода вкладов
Оценка роли V, F и A с помощью метода вкладов
Мы предполагаем, что:
Мы предполагаем, что:
Проверка «инструмента» в лабораторных условиях
Проверка «инструмента» в лабораторных условиях
Общая характеристика эксперимента Постоянная температура (т
Общая характеристика эксперимента Постоянная температура (т
Результаты
Результаты
Результаты
Результаты
Вклады изменений плодовитости и доли взрослых в изменение рождаемости
Вклады изменений плодовитости и доли взрослых в изменение рождаемости
Вклады изменений плодовитости и доли взрослых в изменение рождаемости
Вклады изменений плодовитости и доли взрослых в изменение рождаемости
NR
NR
Вывод (по результатам лабораторных экспериментов)
Вывод (по результатам лабораторных экспериментов)
Осталось проверить, приложим ли этот инструмент к природным популяциям
Осталось проверить, приложим ли этот инструмент к природным популяциям
Пример на макроэкологическую тему: Вероятность оказаться под угрозой
Пример на макроэкологическую тему: Вероятность оказаться под угрозой
Общая экология
Общая экология
Современное вымирание
Современное вымирание
Почему они вымирают
Почему они вымирают
Какие звери преимущественно вымирают
Какие звери преимущественно вымирают
Общее правило (тенденция): Вымирают преимущественно крупные звери
Общее правило (тенденция): Вымирают преимущественно крупные звери
Кто кого «сборет»: человек пещерного медведя или наоборот
Кто кого «сборет»: человек пещерного медведя или наоборот
Гистограммы распределения выживших и вымерших в позднем плейстоцене
Гистограммы распределения выживших и вымерших в позднем плейстоцене
Крупные звери размножаются медленнее
Крупные звери размножаются медленнее
Медленно размножающиеся звери не только чаще вымирают, но и чаще
Медленно размножающиеся звери не только чаще вымирают, но и чаще
Зависимость плотности популяции N (число особей/км2) от массы тела W
Зависимость плотности популяции N (число особей/км2) от массы тела W
Крупные размеры тела, низкая скорость размножения и низкая численность
Крупные размеры тела, низкая скорость размножения и низкая численность
Нужна более фундаментальная причина для вымирания Такой причиной может
Нужна более фундаментальная причина для вымирания Такой причиной может
Мутации, в конечном счете, единственный источник генетической
Мутации, в конечном счете, единственный источник генетической
Геномные – изменение числа хромосом (например, полиплоидизация)
Геномные – изменение числа хромосом (например, полиплоидизация)
Классификация точковых мутаций «по смыслу»
Классификация точковых мутаций «по смыслу»
Таблица генетического кода: синонимические и несинонимические замены
Таблица генетического кода: синонимические и несинонимические замены
Кольцевая ДНК митохондрий млекопитающих с указанным на ней цитохромом
Кольцевая ДНК митохондрий млекопитающих с указанным на ней цитохромом
Нуклеотидная последовательность для цитохрома b из GenBank (1140 bp)
Нуклеотидная последовательность для цитохрома b из GenBank (1140 bp)
Как определяют темп накопления мутаций
Как определяют темп накопления мутаций
От (неблагоприятных) мутаций до вымирания …
От (неблагоприятных) мутаций до вымирания …
Отбор
Отбор
Мутационное «таяние» популяции (mutational meltdown)
Мутационное «таяние» популяции (mutational meltdown)
Kr/Kc polarity
Kr/Kc polarity
Kr/Kc volume
Kr/Kc volume
Крупные звери накапливают больше мутаций
Крупные звери накапливают больше мутаций
Вновь возвращаемся к Красной книге
Вновь возвращаемся к Красной книге
Темп накопления мутаций у млекопитающих, относящихся к разным
Темп накопления мутаций у млекопитающих, относящихся к разным
Метод (инструмент): Логистическая регрессия
Метод (инструмент): Логистическая регрессия
Зависимость вероятности оказаться под угрозой вымирания от темпа
Зависимость вероятности оказаться под угрозой вымирания от темпа
Зависимость вероятности оказаться под угрозой вымирания от темпа
Зависимость вероятности оказаться под угрозой вымирания от темпа
Десять не находящихся под угрозой (LC) видов млекопитающих с высокой
Десять не находящихся под угрозой (LC) видов млекопитающих с высокой
По данным Международной Красной книги около половины современных
По данным Международной Красной книги около половины современных
Возможность прогноза
Возможность прогноза
Связка экологии с популяционной генетикой и биоинформатикой может быть
Связка экологии с популяционной генетикой и биоинформатикой может быть
При изменении условий мутация исходно вредная может оказаться полезной
При изменении условий мутация исходно вредная может оказаться полезной

Презентация на тему: «Общая экология». Автор: Leonard. Файл: «Общая экология.ppt». Размер zip-архива: 3013 КБ.

Общая экология

содержание презентации «Общая экология.ppt»
СлайдТекст
1 Общая экология

Общая экология

http://ecology.genebee.msu.ru leonard_polishchuk@hotmail.com

Леонард Владимирович Полищук

Кафедра общей экологии Биологического факультета МГУ

2 Объем экологии (в прямом и переносном смысле слова)

Объем экологии (в прямом и переносном смысле слова)

Вес этой недавно вышедшей сводки, в которой каждому из выделенных авторами > 90 разделов экологии уделено лишь около 10 страниц, – почти 2 кг!

Структура экологии согласно The Princeton Guide to Ecology: аутэкология популяционная экология сообщества и экосистемы ландшафты и биосфера охрана природы (conservation biology) какую пользу экосистемы приносят человеку (ecosystem services) управление биосферой (biosphere management)

The Princeton Guide to Ecology Edited by Simon A. Levin Associate editors: Stephen R. Carpenter, H. Charles J. Godfray, Ann P. Kinzig, Michel Loreau, Jonathan B. Losos, Brian Walker & David S. Wilcove. Princeton Univ. Press, 2009. 848 pp.

3 Как устроена экология, или чем отличается зрелая наука от незрелой

Как устроена экология, или чем отличается зрелая наука от незрелой

Soft Science (незрелая наука) Образ: (филогенетический) газон

Hard Science (зрелая наука) Образ: (филогенетическое) дерево

Экология ближе к незрелой науке …

Пример зрелой науки - физика

4 Идеал количественной науки

Идеал количественной науки

Открытие Леверье планеты Нептун: Леверье предсказал положение Нептуна, исходя из несоответствия между наблюдаемой орбитой Урана и той, которая должна была бы быть согласно законам Кеплера и Ньютона. Галле направил телескоп на указанную Леверье точку небесного свода и действительно нашел там новую планету!

Схема Солнечной системы: http://solarsystem.nasa.gov/planets/index.cfm

1846 г. – открытие Нептуна 1848 г. – избрание Леверье иностранным членом Петербургской Академии Наук

5 Определение экологии, или многое ли мы узнаём из определения науки

Определение экологии, или многое ли мы узнаём из определения науки

Теория вероятностей – пример зрелой науки. Что же мы узнаем из определения теории вероятностей?

Теория вероятностей – это наука о вероятностях! ?

Не следует слишком многого ждать от определений …

Обратимся к Советскому энциклопедическому словарю (1982): «Вероятностей теория, раздел математики, в котором по данным вероятностям одних случайных событий находят вероятности других событий, связанных каким-либо образом с первыми.»

6 Как на этом фоне обстоит дело с определением экологии

Как на этом фоне обстоит дело с определением экологии

Не так уж плохо!

Экология – наука о взаимоотношениях организмов (популяций) между собой и с окружающей средой

«Термин экология был введен Э. Геккелем в 1866 г. Биологический энциклопедический словарь (1989) определяет экологию как «биологическую науку, изучающую организацию и функционирование надорганизменных систем различных уровней: популяций, биоценозов (сообществ), биогеоценозов (экосистем) и биосферы» … Это определение может нравиться или нет, но в самом существенном оно бесспорно: экология – это биологическая наука, изучающая надорганизменные системы. С другой стороны, в печати или в устной речи мы постоянно сталкиваемся со словосочетаниями типа «экология памятников», «экология языка», «экология культуры», даже «экология нашего двора». … Еще смешнее выглядят словосочетания «плохая экология» или «хорошая экология». Этак можно договориться до чего угодно. Скажем, в моем любимом городе Феодосии «плохая геометрия»; евклидовы законы там не соблюдаются, поскольку город расположен на подковообразном склоне.» (Е.А. Нинбург. Введение в общую экологию. М. 2005, с. 6)

7 Экология как разномасштабная наука

Экология как разномасштабная наука

Популяционная экология

Макроэкология

Более или менее универсальные инструменты популяционного анализа

Более или менее универсальные экологические зависимости

Локальный масштаб – почти полное отсутствие усреднения

Глобальный масштаб – высокая степень усреднения

8 Эта схема не отрицает возможности создания теории экологических

Эта схема не отрицает возможности создания теории экологических

явлений как в локальном, так и, тем более, в глобальном масштабе. Она лишь пытается расставить приоритеты: поиск (более или менее) универсальных инструментов в локальном масштабе и поиск (более или менее) универсальных зависимостей в глобальном масштабе

9 Универсальный инструмент – что это

Универсальный инструмент – что это

Своего рода термометр …

Изображения с сайтов: http://nkozlov.ru/library/s318/d3458/ http://picasaweb.google.com/olgazubko

10 Содержание лекции: Две экологические задачи

Содержание лекции: Две экологические задачи

Оценка рождаемости в популяциях планктонных животных как пример поиска «экологического инструмента» вероятность оказаться под угрозой вымирания в зависимости от темпа накопления мутаций у млекопитающих как пример поиска экологической (эколого-генетической) зависимости

11 Пример на тему популяционного анализа: Как оценивают рождаемость

Пример на тему популяционного анализа: Как оценивают рождаемость

дафний и что из этой оценки можно извлечь

12 Два основных эффекта – top-down и bottom-up

Два основных эффекта – top-down и bottom-up

Как сравнить силу воздействия со стороны хищников (top-down effect) с силой воздействия со стороны пищи (bottom-up effect)?

Фото с сайтов http://www.nwri.ca © NOAA, Ann Arbor, Michigan, www.biologie.uni-muenchen.de, © Wilfried Gabriel www.icb.ufmg.br/bot/ficolog

13 Размерно-избирательная элиминация планктонных рачков рыбами

Размерно-избирательная элиминация планктонных рачков рыбами

Alosa (= Pomolobus) pseudoharengus

Brooks J. L., Dodson S. L. Predation, body size, and composition of plankton. Science. 1965. V. 150. P. 28-35

14 b = V ln(1 + FA) Демографические показатели, влияющие на b: V = 1/De –

b = V ln(1 + FA) Демографические показатели, влияющие на b: V = 1/De –

скорость развития яиц, сут-1 F = E/Na – плодовитость (отношение числа яиц к числу взрослых) A = Na/N– доля взрослых особей (от общей численности популяции)

Модель Эдмондсона-Палохеймо как (более или менее) универсальный инструмент для оценки и анализа рождаемости планктонных животных

Фото с сайта www.biologie.uni-muenchen.de ©Wilfried Gabriel

15 ВЛИЯНИЕ СРЕДЫ НА РОЖДАЕМОСТЬ b опосредовано скоростью развития яиц V,

ВЛИЯНИЕ СРЕДЫ НА РОЖДАЕМОСТЬ b опосредовано скоростью развития яиц V,

плодовитостью F и долей взрослых A

Температура

Скорость развития яиц V = 1/de

Пища

О к р у ж а ю щ а я с р е д а

Плодовитость F = E/na

b

Размерно- избирательные хищники

Доля взрослых A = na/N

16 Оценка роли V, F и A с помощью метода вкладов

Оценка роли V, F и A с помощью метода вкладов

?b ? ln(1+ F?A)??V + [V?A/(1+F?A)]??F + [V?F/(1+F?A)]??A

y = f (x1, x2, …, xn) ?y ? ? (?y/?xi) ?xi

b = V ln(1+ F?A)

?b ? (? b/? V)??V + (? b/? F)??F + (? b/? A)??A

Изменение рождаемости

Вклад изменения скорости развития яиц

Вклад изменения доли взрослых

Вклад изменения плодовитости

Сумма вкладов в изменение рождаемости

17 Мы предполагаем, что:

Мы предполагаем, что:

(1) При преобладающем влиянии пищи ведущая роль в динамике рождаемости принадлежит изменению плодовитости (количеству яиц в расчете на одну взрослую самку).

(2) При преобладающем влиянии хищников ведущая роль в динамике рождаемости принадлежит изменению размерно-возрастной структуры – в силу того, что пресс хищников в планктоне обычно носит размерно-избирательный характер

(3) Соотношение эффектов плодовитости и доли взрослых на рождаемость позволяет судить об относительной силе воздействия факторов внешней среды – пищи и хищников

18 Проверка «инструмента» в лабораторных условиях

Проверка «инструмента» в лабораторных условиях

Динамика рождаемости Daphnia galeata в лабораторных микрокосмах при разном характере размерно-избирательной элиминации и сопряженной с ним разной пищевой обеспеченности

Polishchuk, L.V., Vijverberg, J., Voronov, D.A., Mooij, W.M. Separating Top-down from Bottom-up Effects in Daphnia: Contribution Analysis of Birth Rate (in preparation)

19 Общая характеристика эксперимента Постоянная температура (т

Общая характеристика эксперимента Постоянная температура (т

е. D = const) и световой режим, поддержание качественного состава пищи на одном и том же уровне Регулярное внесение пищи и регулярный темп элиминации Только конкуренция за пищу и размерно- выборочная элиминация действуют в системе, причем эти два фактора действуют одновременно, хотя и с разной силой

20 Результаты

Результаты

Численность Daphnia galeata

No Removal

Removal-of-Small

Removal-of-Large

21 Результаты

Результаты

Плодовитость Daphnia galeata

Removal-of-Small

Removal-of-Large

No Removal

22 Вклады изменений плодовитости и доли взрослых в изменение рождаемости

Вклады изменений плодовитости и доли взрослых в изменение рождаемости

при отсутствии размерно-избирательной элиминации (режим конкуренции – недостаток пищи)

Con F – вклад изменения плодовитости

Con A – вклад изменения доли взрослых особей

?B – изменение рождаемости (в расчете на сутки)

Номер интервала между пробами от начала эксперимента

23 Вклады изменений плодовитости и доли взрослых в изменение рождаемости

Вклады изменений плодовитости и доли взрослых в изменение рождаемости

при избирательной элиминации взрослых дафний (имитация пресса рыб)

Con F – вклад изменения плодовитости

Con A – вклад изменения доли взрослых особей

?B – изменение рождаемости (в расчете на сутки)

Номер интервала между пробами от начала эксперимента

24 NR

NR

RS

RL

Microcosm experiments

Microcosm experiments

Microcosm experiments

Microcosm experiments

Computer simulations

Computer simulations

Computer simulations

Computer simulations

Сводка результатов лабораторных и компьютерных экспериментов

NR (no removal) – режим конкуренции RS (removal-of-small) – элиминация молоди дафний («пресс беспозв. Хищников») RL (removal-of-large) – элиминация взрослых дафний («пресс рыб»)

Treat-ment

Treat-ment

1.28 (0.08)

0.14 (0.009)

-0.35 (0.18)

0.70

1.22 (0.13)

0.30 (0.02)

-0.60 (0.50)

0.55

2.05 (0.12)

0.23 (0.012)

0.75 (0.32)

2.12

2.35 (0.36)

0.27 (0.03)

-0.29 (0.48)

0.75

3.22 (0.05)

0.12 (0.008)

0.78 (0.24)

2.18

3.39 (0.30)

0.17 (0.03)

0.72 (0.51)

2.05

25 Вывод (по результатам лабораторных экспериментов)

Вывод (по результатам лабораторных экспериментов)

По соотношению вкладов изменения доли взрослых и изменения плодовитости в динамику рождаемости можно исключить либо фактор пищи (когда отношение вкладов около 2), либо фактор рыб (когда отношение вкладов 0.5-0.7) как возможную причину динамики численности данной популяции дафний. Отличить эффект беспозвоночных хищников от эффекта пищи и эффекта рыб пока не представляется возможным, однако можно полагать, что эффект беспозвоночных хищников лишь в редких случаях является доминирующим.

26 Осталось проверить, приложим ли этот инструмент к природным популяциям

Осталось проверить, приложим ли этот инструмент к природным популяциям

… Если да, то:

Мы пришли на берег водоема, бросили планктонную сеть, подсчитали плодовитость и долю взрослых особей в популяции дафний и … определили ведущий фактор динамики численности этих дафний – недостаток пищи (возможно, с «примесью» беспозвоночных хищников) или пресс рыб (опять же, возможно, с «примесью» беспозвоночных хищников).

Температура на нашем «экологическом термометре» – это соотношение силы воздействия ведущих экологических факторов

Фото: Е.А. Мнацаканова

27 Пример на макроэкологическую тему: Вероятность оказаться под угрозой

Пример на макроэкологическую тему: Вероятность оказаться под угрозой

вымирания в зависимости от темпа накопления мутаций («генетического груза») у млекопитающих

28 Общая экология
29 Современное вымирание

Современное вымирание

Каков темп накопления мутаций у тех, кто под угрозой, и у тех, кто не под угрозой?

Под угрозой

Не под угрозой

Источником данных по современному вымиранию является Красная книга

Международная Красная книга (IUCN Red List) Структура Международной Красной книги (категории видов)

EX – исчезнувшие EW – исчезнувшие в дикой природе CR – находящиеся на грани исчезновения EN – исчезающие (в опасности) VU – уязвимые NT – находящиеся в состоянии, близком к угрожаемому LC – вызывающие наименьшие опасения DD – недостаточно данных NE – оценка не дана

30 Почему они вымирают

Почему они вымирают

Внешний аспект вымирания

Квартет внешних факторов (Diamond’s quartet), ведущих к вымиранию:

Разрушение природных местообитаний Чрезмерная эксплуатация (неограниченная охота, перевылов) Виды-вселенцы (особенно опасны для островных эндемиков) Цепная реакция вымирания (разрушение нижних трофических уровней приводит к вымиранию верхних)

31 Какие звери преимущественно вымирают

Какие звери преимущественно вымирают

Шерстистые мамонты (Mammuthus primigenius) в тундростепном ландшафте. Источник: Sedwick C. What Killed the Woolly Mammoth? PLoS Biol 6(4): e99 (2008)

32 Общее правило (тенденция): Вымирают преимущественно крупные звери

Общее правило (тенденция): Вымирают преимущественно крупные звери

Пример: В позднем плейстоцене (на большинстве континентов 12-15 тыс. лет назад) преимущественно вымирали крупные звери

Только ли под действием человека? Не были ли крупные предрасположены к вымиранию?

Источник: S. K. Lyons, F. A. Smith and J. H. Brown. 2004. Of mice, mastodons and men: human mediated extinctions on four continents. Evolutionary Ecology Research 6: 339-358.

33 Кто кого «сборет»: человек пещерного медведя или наоборот

Кто кого «сборет»: человек пещерного медведя или наоборот

Пещерный медведь Художник: Зденек Буриан Источник: http://macroevolution.narod.ru/burian.htm

34 Гистограммы распределения выживших и вымерших в позднем плейстоцене

Гистограммы распределения выживших и вымерших в позднем плейстоцене

видов млекопитающих по массе тела

Материал тот же, что и на предыдущем слайде

4 континента, 2123 вида

35 Крупные звери размножаются медленнее

Крупные звери размножаются медленнее

rm ~ W-0.27

Для сравнения показана зависимость удельного обмена от массы (с показателем степени -0.25)

Log (уд. Скорость роста численности, rm)

Log (масса тела, W)

Источник: Fenchel T. 1974. Oecologia 14: 317-326, Figure 1

36 Медленно размножающиеся звери не только чаще вымирают, но и чаще

Медленно размножающиеся звери не только чаще вымирают, но и чаще

оказываются под угрозой вымирания

Chance of listing – технический термин, означающий, вероятность попасть в Красную книгу

Источник: Polishchuk L.V. Conservation priorities for Russian mammals. 2002. Science 297: 1123

37 Зависимость плотности популяции N (число особей/км2) от массы тела W

Зависимость плотности популяции N (число особей/км2) от массы тела W

(г) для растительноядных млекопитающих lg N = -0.73 lg W + 4.15 (r = - 0.8, n = 368)

Крупные звери вдобавок еще и малочисленны

Каждая точка -один вид

Источник: Damuth J. 1987. Biol. J. Linn. Soc. 31: 193-246, Figure 1

38 Крупные размеры тела, низкая скорость размножения и низкая численность

Крупные размеры тела, низкая скорость размножения и низкая численность

несомненно, скоррелированы с вымиранием (вплоть до того, что по зависимости численности от массы можно количественно предсказать зависимость вероятности вымирания от массы тела). Однако могут ли они сами по себе быть причиной вымирания? Представляется, что нет, поскольку крупные организмы имеют свойства, компенсирующие, по крайней мере отчасти, «недостатки» низкой численности: долговечность взрослых, относительно низкая смертность молоди (результат заботы о потомстве), наконец, самое, может быть, главное с точки зрения вымирания – численность крупных, хотя и низка, зато относительно стабильна

39 Нужна более фундаментальная причина для вымирания Такой причиной может

Нужна более фундаментальная причина для вымирания Такой причиной может

быть накопление мутаций

40 Мутации, в конечном счете, единственный источник генетической

Мутации, в конечном счете, единственный источник генетической

изменчивости de novo. Однако благоприятных мутаций мало. Почти все мутации снижают приспособленность.

Неблагоприятные мутации – летальные, вредные, слабовредные. Летальные и вредные с сильно выраженным эффектом отсекаются на индивидуальном уровне, в эволюции большой роли не играют, поскольку не могут быть переданы потомкам. Слабовредные, напротив, играют значительную роль в эволюции.

41 Геномные – изменение числа хромосом (например, полиплоидизация)

Геномные – изменение числа хромосом (например, полиплоидизация)

Хромосомные (делеция, дупликация, инверсия и транслокация) Нуклеотидные (точковые) – замены, делеции и вставки нуклеотидов

«Морфология» мутаций

Азотистые основания, входящие в ДНК и РНК

3

1

Аденин (A)

Гуанин (G)

Цитозин (C)

Тимин (T)

Урацил (T)

Два типа замен – транзиции и трансверсии Азотистые основания – пурины (аденин и гуанин) и пиримиды (цитозин, тимин и урацил) Транзиция – замена пурина на пурин и пиримидина на пиримидин Трансвесия – замена пурина на пиримидин и пиримидина на пурин

42 Классификация точковых мутаций «по смыслу»

Классификация точковых мутаций «по смыслу»

Несинонимические нуклеотидные замены, приводящие к замене аминокислоты, - это и есть мутации в узком смысле, темп накопления которых у данного вида мы хотим найти

Сохранение смысла кодона из-за вырожденности генетического кода (синонимическая замена нуклеотида) Изменение смысла кодона, приводящее к замене аминокислоты (несинонимическая замена нуклеотида) Образование бессмысленного кодона (нонсенс-мутация, или образование стоп-кодона) Мутация, обратная к 3), то есть замена стоп-кодона на смысловой кодон

Вырожденность генетического кода: 61 кодон кодирует 20 аминокислот

43 Таблица генетического кода: синонимические и несинонимические замены

Таблица генетического кода: синонимические и несинонимические замены

Вырожденность генетического кода неравномерна!

Схема с сайта: http://www.geneticsolutions.com/...530:1873

44 Кольцевая ДНК митохондрий млекопитающих с указанным на ней цитохромом

Кольцевая ДНК митохондрий млекопитающих с указанным на ней цитохромом

Источник: http://herkules.oulu.fi/isbn9514255364/html/x128.html

Codon Table

45 Нуклеотидная последовательность для цитохрома b из GenBank (1140 bp)

Нуклеотидная последовательность для цитохрома b из GenBank (1140 bp)

>Desmana_moschata (выхухоль) ATGACAAATATCCGAAAAACCCACCCCATTATAAAGATTATTAACGACTCTTTCATTGATTTACCAACACCATCAAACATTTCATCCTGATGAAATTTTGGTTCGCTCTTAGGGATTTGCTTAGTTATCCAAATTATCACAGGACTATTCCTCGCAATACACTACACACCAGACACCATAACAGCCTTCTCATCAGTAACCCACATCTGCCGAGACGTAAACTACGGCTGACTTATCCGATACCTTCATGCAAACGGGGCTTCCATATTTTTTATTTGTTTATTCCTACATGTAGGTCGAGGACTATATTATGGATCCTACATATTCACAGAAACTTGAAATATTGGAGTATTACTATTATTCGCCACTATAGCCACTGCATTCATAGGGTACGTTCTGCCATGGGGTCAAATATCCTTTTGAGGCGCAACGGTAATTACAAATTTATTGTCAGCCATTCCTTACATCGGAACAGACCTTGTAGAATGAATCTGAGGAGGTTTTTCAGTAGATAAAGCAACACTGACCCGATTTTTTGCTTTCCATTTTATTCTGCCATTCATTATTGCAGCTATGGCTGGCGTACATTTATTATTCCTTCATGAAACTGGTTCTAATAACCCTTCCGGACTGTTATCTGACGCTGACAAAATCCCATTCCACCCATATTATACCATTAAAGACACTCTAGGAGCCCTAGCCCTTATCACAGTATTATCCCTACTCGTATTATTTTCACCAGACCTATTAGGAGACCCAGACAACTATACTCCAGCCAACCCACTAAACACACCACCCCACATTAAACCAGAATGATACTTCCTATTCGCATACGCAATCCTACGTTCAATTCCTAACAAACTAGGAGGTGTTTTAGCTCTAGTTATATCTATTCTAGTCCTAGCACTAATACCATTCCTACATACCTCAAAACAACGAAGCATGATATTCCGACCTATTAGCCAATGCTTATTCTGATTACTAGTGGCCGACCTACTTGTATTAACATGAATTGGAGGCCAACCAGTAGAGCACCCTTTCATCATCATCGGCCAAGTAGCCTCAATCCTTTACTTCCTCTTAATCCTAGTATTAATACCACTGGCAAGCATTATAGAAAACAACTTACTCAAATGA

Фото: Нелли Зарипова Источник: http://www.biodiversity.ru/programs/vyhuh/gallery/photoalbum.html

46 Как определяют темп накопления мутаций

Как определяют темп накопления мутаций

Отношение (относительного) числа несинонимических замен (большинство из которых слабовредные) к (относительному) числу синонимических замен есть мера темпа накопления мутаций.

Идем в GenBank (http://www.ncbi.nlm.nih.gov/Genbank/ ) и извлекаем из него нужную нам нуклеотидную последовательность Сравниваем нуклеотидные последовательности разных видов (sequence alignment, или выравнивание), то есть записываем их одну под другой, чтобы было как можно больше совпадений, например

Вид 1

T

g

t

A

C

c

T

C

g

T

g

G

-

A

A

-

-

Вид 2

T

-

-

A

C

-

T

C

a

T

a

G

c

A

A

c

c

На основании сравнения строим филогенетическое дерево (исходя из того, что близкие виды имеют сходные последовательности). В концевых точках этого дерева находятся современные виды, а в ближайших узлах – их общие предки (т.е. реконструированные последовательности) Сравниваем последовательности современных видов и их ближайших предков, выделяем триплеты нуклеотидов, среди них находим различающиеся, а среди различающихся – триплеты с синонимическими заменами и триплеты с несинонимическими заменами

47 От (неблагоприятных) мутаций до вымирания …

От (неблагоприятных) мутаций до вымирания …

Отбор

Дрейф

Неблагоприятные мутации

Генетический груз

«Объем» мутаций подпитывается новыми мутациями, сокращается «очищающим» отбором и поддерживается генетическим дрейфом

Вымирание

48 Отбор

Отбор

Дрейф

Соотношение между отбором и дрейфом зависит от численности

Высокая численность

Низкая численность

Отбор неэффективен в популяциях с низкой численностью, а дрейф – наоборот (population bottleneck – популяционное узкое место, «бутылочное горлышко»)

Чем ниже численность, тем менее эффективен отбор и более эффективен дрейф

49 Мутационное «таяние» популяции (mutational meltdown)

Мутационное «таяние» популяции (mutational meltdown)

N1

N2 < N1

Воронка снижаю щейся числ енн ос т и

Низкая численность

Сильный дрейф

Больше генетический груз

Ниже рождаемость и выше смертность

N2

Положительная обратная связь между низкой численностью, сильным дрейфом и накоплением мутаций

50 Kr/Kc polarity

Kr/Kc polarity

Kr/Kc volume

Ka/Ks

Kr/Kc polarity-volume

Kr/Kc charge

Grantham distance

Comparison of averages of six molecular traits for 55 small (ln W < 9.04) and 55 large (ln W > 9.04) mammals where 9.04 is the median of loge transformed body mass W (in grams)

Popadin K., Polishchuk L.V., Mamirova L., Knorre D., and Gunbin K. 2007. Accumulation of slightly deleterious mutations in mitochondrial protein-coding genes of large versus small mammals. PNAS 104: 13390-13395

©2007 by National Academy of Sciences

51 Kr/Kc volume

Kr/Kc volume

Ka/Ks

Kr/Kc polarity

Grantham distance

Kr/Kc polarity-volume

Kr/Kc charge

The ordinary linear regressions of molecular traits on loge body mass W for 110 mammalian species

Popadin K., Polishchuk L.V., Mamirova L., Knorre D., and Gunbin K. 2007. Accumulation of slightly deleterious mutations in mitochondrial protein-coding genes of large versus small mammals. PNAS 104: 13390-13395

©2007 by National Academy of Sciences

52 Крупные звери накапливают больше мутаций

Крупные звери накапливают больше мутаций

Но достаточно ли этого для вымирания?

До сих пор в нашем распоряжении были только косвенные свидетельства …

53 Вновь возвращаемся к Красной книге

Вновь возвращаемся к Красной книге

Каков темп накопления мутаций у тех, кто под угрозой, и у тех, кто не под угрозой?

Под угрозой

Не под угрозой

Структура Международной Красной книги (категории видов)

EX – исчезнувшие EW – исчезнувшие в дикой природе CR – находящиеся на грани исчезновения EN – исчезающие (в опасности) VU – уязвимые NT – находящиеся в состоянии, близком к угрожаемому LC – вызывающие наименьшие опасения DD – недостаточно данных NE – оценка не дана

54 Темп накопления мутаций у млекопитающих, относящихся к разным

Темп накопления мутаций у млекопитающих, относящихся к разным

категориям риска вымирания – от вызывающих наименьшие опасения (LC) до находящихся в опасности (EN и CR)

Ka/ks – скорость на-копления несиноними-ческих замен по отношению к скорости накопления синоними-ческих замен

Mean Ka/Ks for groups of mammals with a certain conservation status which is established according to the IUCN Red List and ranges from least concern (LC, n = 122) to near threatened (NT, n = 22) to vulnerable (VU, n = 29) to endangered (EN, n = 29) to critically endangered (CR, n = 9) species. Means and standard errors (SE) are originally calculated on the basis of log transformed data. The values presented in the figure are obtained through back transformation (Sokal and Rohlf 1995: 413-415).

55 Метод (инструмент): Логистическая регрессия

Метод (инструмент): Логистическая регрессия

Логистическая функция

Как описать зависимость вероятности оказаться под угрозой вымирания от темпа накопления мутаций?

Или

b > 0

b < 0

56 Зависимость вероятности оказаться под угрозой вымирания от темпа

Зависимость вероятности оказаться под угрозой вымирания от темпа

накопления мутаций у млекопитающих (на материале 211 видов)

Probability of being at risk (green line) in relation to mutation accumulation rate, Ka/Ks, based on a logistic regression of the binary variable of least concern (LC) species, each of which is assigned 0, vs. near threatened (NT), vulnerable (VU), endangered (EN) and critically endangered (CR) species combined, each of which is assigned 1, on loge(Ka/Ks). For a regression equation see text. Also shown are the frequency distributions for the least concern (blue polygon with bars) and the more threatened (NT+VU+EN+CR; red polygon with bars) species. The red polygon is shifted to the right relative to the blue one (p < 0.005, Kolmogorov-Smirnov test), which manifests a generally increasing trend in extinction risk with increasing Ka/Ks. However at the far right end of the distributions the situation seems to be reversed.

57 Зависимость вероятности оказаться под угрозой вымирания от темпа

Зависимость вероятности оказаться под угрозой вымирания от темпа

накопления мутаций

58 Десять не находящихся под угрозой (LC) видов млекопитающих с высокой

Десять не находящихся под угрозой (LC) видов млекопитающих с высокой

скоростью накопления мутаций (шесть из них приматы) (эта скорость сравнима или даже превосходит верхнюю границу скорости накопления мутаций у видов, находящихся под угрозой)

Primates

Primates

Primates

Primates

Primates

Primates

Carnivora

Pilosa

Eulipotyphla

Pilosa

Species

Common name

Order

Family

Status

Ka/Ks

loge (Ka/Ks)

1

Macaca fascicularis

Яванский макак (крабоед)

Cercopithecidae

LC

0.1397

-1.97

2

Ursus arctos

Бурый медведь

Ursidae

LC

0.1223

-2.10

3

Chlorocebus sabaeus

Зеленая мартышка

Cercopithecidae

LC

0.1202

-2.12

4

Chlorocebus aethiops

Гривет (Grivet Monkey)

Cercopithecidae

LC

0.1177

-2.14

5

Bradypus tridactylus

Трехпалый ленивец

Bradypodidae

LC

0.1016

-2.29

6

Chlorocebus pygerythrus

Верветка (Vervet)

Cercopithecidae

LC

0.1001

-2.30

7

Chlorocebus tantalus

Tantalus Monkey

Cercopithecidae

LC

0.0983

-2.32

8

Macaca mulatta

Макак-резус

Cercopithecidae

LC

0.0981

-2.32

9

Erinaceus europaeus

Обыкнов. ёж

Erinaceidae

LC

0.0946

-2.36

10

Choloepus didactylus

Двупалый ленивец

Megalonychidae

LC

0.0902

-2.41

59 По данным Международной Красной книги около половины современных

По данным Международной Красной книги около половины современных

приматов находятся под угрозой вымирания – против 25% «краснокнижных» видов от общего числа видов млекопитающих Полученные данные показывают, что приматов также непропорционально много среди видов, которые в настоящее время находятся в безопасности, но при этом имеют высокий темп накопления мутаций и поэтому являются потенциальными кандидатами на вымирание

60 Возможность прогноза

Возможность прогноза

Десять не находящихся в настоящее время под угрозой видов млекопитающих с высокой скоростью накопления мутаций – это потенциальные кандидаты на то, чтобы оказаться под угрозой вымирания. Эти виды предрасположены к тому, чтобы оказаться под угрозой вымирания в силу генетических причин Макроэкологический (сравнительно-видовой) анализ позволяет не только построить зависимость вероятности оказаться под угрозой вымирания от темпа накопления мутаций, но и сделать прогноз, какие виды могут оказаться под угрозой при дальнейшем нарастании антропогенного пресса

61 Связка экологии с популяционной генетикой и биоинформатикой может быть

Связка экологии с популяционной генетикой и биоинформатикой может быть

одной из точек роста современной биологии

62 При изменении условий мутация исходно вредная может оказаться полезной

При изменении условий мутация исходно вредная может оказаться полезной

Классический пример превращения вредной мутации в полезную – меланизм березовой пяденицы (Biston betularia)

Не думайте, что все мутации вредные. Полезные мутации тоже бывают ?

Поскольку речь шла о вымирании, нас интересовали здесь только не-благоприятные мутации. Таких действительно большинство. Тем не менее не все мутации неблагоприятные (например, возникновение устойчивости к антибиотикам – мутация, полезная для бактерий)

А

Б

Пятнистая и темная формы березовой пяденицы на стволе, покрытом лишайником (слева), и на темном стволе без лишайников

До эры индустриального меланизма на березе жили лишайники (а). Потом лишайники погибли, а кора почернела (б).

Фото: http://bill.srnr.arizona.edu/classes/182/Melanism/Kettlewell.htm

«Общая экология»
http://900igr.net/prezentacija/ekologija/obschaja-ekologija-80071.html
cсылка на страницу

Экология

25 презентаций об экологии
Урок

Экология

30 тем
Слайды