Передача информации
<<  Невербальные средства передачи информации Передача информации в компьютерных сетях (КС). Структура КС. Локальные КС  >>
Институт проблем передачи информации РАН (http://www
Институт проблем передачи информации РАН (http://www
С 2000 года нами опубликовано: 2 монографии и 1 вузовский учебник (по
С 2000 года нами опубликовано: 2 монографии и 1 вузовский учебник (по
Ежегодно наши аспиранты и сотрудники делают доклады примерно на 4-х
Ежегодно наши аспиранты и сотрудники делают доклады примерно на 4-х
Тесно сотрудничаем с кафедрой «математической логики и теории
Тесно сотрудничаем с кафедрой «математической логики и теории
Проблемы эффективности; 2) Модели и алгоритмы основных молекулярных
Проблемы эффективности; 2) Модели и алгоритмы основных молекулярных
Модели и алгоритмы (компьютерный счет)
Модели и алгоритмы (компьютерный счет)
Ген считывается по сигналу из лидерной области
Ген считывается по сигналу из лидерной области
Один из возможных типов сигналов (= регуляций):
Один из возможных типов сигналов (= регуляций):
Даны n последовательностей
Даны n последовательностей
Ищем систему сайтов с максимальным значением качества, т.е. ищем
Ищем систему сайтов с максимальным значением качества, т.е. ищем
Индуктивный шаг: от
Индуктивный шаг: от
Пример
Пример
Работа алгоритма:
Работа алгоритма:
Результат работы алгоритма:
Результат работы алгоритма:
Качество потенциального сигнала растет в процессе счета:
Качество потенциального сигнала растет в процессе счета:
Последовательное изменение качества сигнала в ходе алгоритма:
Последовательное изменение качества сигнала в ходе алгоритма:
Параллельная реализация вычислительно трудоемких алгоритмов: поиск
Параллельная реализация вычислительно трудоемких алгоритмов: поиск
Wavelike computation scheme
Wavelike computation scheme
Параллельная реализация вычислительно трудоемких алгоритмов:
Параллельная реализация вычислительно трудоемких алгоритмов:
x
x
«Спираль» с «плечами», склеиваются G с C и A с T:
«Спираль» с «плечами», склеиваются G с C и A с T:
Реальные еще очень простые вторичные структуры (=наборы спиралей):
Реальные еще очень простые вторичные структуры (=наборы спиралей):
T
T
Результат одной нашей моделей регуляции:
Результат одной нашей моделей регуляции:
Примеры результатов счета в этой модели
Примеры результатов счета в этой модели
Два основных направления нашей работы в Биоинформатике:
Два основных направления нашей работы в Биоинформатике:
Дано дерево G , у которого длины ребер соответ-ствуют времени переходу
Дано дерево G , у которого длины ребер соответ-ствуют времени переходу
Иногда ищется и само дерево : тогда даны только современные
Иногда ищется и само дерево : тогда даны только современные
?Конфигурация
?Конфигурация
Наша модель эволюции сигнала:
Наша модель эволюции сигнала:
?'j
?'j
Показано одно ребро от конфигурации
Показано одно ребро от конфигурации
Решение (фрагмент): эволюция предкового сигнала
Решение (фрагмент): эволюция предкового сигнала
Поиск и эволюция сигнала другого типа («промотора»): некоторой
Поиск и эволюция сигнала другого типа («промотора»): некоторой
На следующем слайде показан удивительно консервативный (=устойчивый
На следующем слайде показан удивительно консервативный (=устойчивый
TTGACATGGCT=ATATAAGTCATGTTATACT Arabidop
TTGACATGGCT=ATATAAGTCATGTTATACT Arabidop
Институт проблем передачи информации РАН (http://www
Институт проблем передачи информации РАН (http://www
Пример интересной темы для исследования – связь (РЕР) промоторов и
Пример интересной темы для исследования – связь (РЕР) промоторов и
Переходы, возможные в нашей модели регуляции, которая связана со
Переходы, возможные в нашей модели регуляции, которая связана со
В модели с предыдущего слайда ищется (выход алгоритма) зависимость
В модели с предыдущего слайда ищется (выход алгоритма) зависимость
Что можно читать по этим темам:
Что можно читать по этим темам:
Наши биологические результаты (дает некоторый обзор, для слушателей не
Наши биологические результаты (дает некоторый обзор, для слушателей не
2. Предложены новые типы регуляции экспрессии генов: 2.1 Регуляция на
2. Предложены новые типы регуляции экспрессии генов: 2.1 Регуляция на
2.3 Сложные типы классической аттенюаторной регуляции (когда
2.3 Сложные типы классической аттенюаторной регуляции (когда
2.6 Регуляция, опосредованная аномально длинной спиралью РНК, генов,
2.6 Регуляция, опосредованная аномально длинной спиралью РНК, генов,
3. Найдены новые случаи известных типов регуляции у бактерий:
3. Найдены новые случаи известных типов регуляции у бактерий:
3.3 Проведен широкомасштабный поиск регуляции на уровне транскрипции
3.3 Проведен широкомасштабный поиск регуляции на уровне транскрипции
3.5 Предсказана регуляция на уровне трансляции посредством тиаминового
3.5 Предсказана регуляция на уровне трансляции посредством тиаминового
4. Белок-РНКовая регуляция в пластидах:
4. Белок-РНКовая регуляция в пластидах:
4.4 Найдена ортологичная консервативная регуляция гена ycf24 на уровне
4.4 Найдена ортологичная консервативная регуляция гена ycf24 на уровне
5. Промоторы бактериального типа в пластидах и соответствующие им
5. Промоторы бактериального типа в пластидах и соответствующие им
5.3 Исследованы Sig3-зависимые промоторы перед геном psbN у семенных
5.3 Исследованы Sig3-зависимые промоторы перед геном psbN у семенных
5.4 Найдены высоко консервативные хлоропластные промоторы
5.4 Найдены высоко консервативные хлоропластные промоторы
5.5 Найдены промоторы перед геном rps20 и близлежащие сайты связывания
5.5 Найдены промоторы перед геном rps20 и близлежащие сайты связывания
6. Найдена общая белок-ДНКовая регуляция экспрессии ядерных генов,
6. Найдена общая белок-ДНКовая регуляция экспрессии ядерных генов,
Эти виды являются вторичными симбионтами и имеют пластиды с общим
Эти виды являются вторичными симбионтами и имеют пластиды с общим

Презентация на тему: «Институт проблем передачи информации РАН». Автор: Vassily Lyubetsky. Файл: «Институт проблем передачи информации РАН.ppt». Размер zip-архива: 792 КБ.

Институт проблем передачи информации РАН

содержание презентации «Институт проблем передачи информации РАН.ppt»
СлайдТекст
1 Институт проблем передачи информации РАН (http://www

Институт проблем передачи информации РАН (http://www

iitp.ru) Лаборатория математических методов и моделей в биоинформатике (http://lab6.iitp.ru)

д.ф.-м.н. проф. зав лаб Любецкий Василий Александрович (lyubetsk@iitp.ru)

2 С 2000 года нами опубликовано: 2 монографии и 1 вузовский учебник (по

С 2000 года нами опубликовано: 2 монографии и 1 вузовский учебник (по

математике) и 23 статьи в математических журналах (Успехи мат. наук, Труды института им. Стеклова, Мат. Заметки и т.д.)

А также – опубликовано 36 статей в биологических и информатических журналах (Молекулярная биология, Биофизика, Биохимия, FEMC, ВМС, JBCB, inSB, ...) Подготовлено 2 докторские и 3 кандидатские диссертации (все – физ.-мат. науки, «теоретические основы информатики», «биоинформатика»)

3 Ежегодно наши аспиранты и сотрудники делают доклады примерно на 4-х

Ежегодно наши аспиранты и сотрудники делают доклады примерно на 4-х

международных конференциях (математических, биологических, информатических) За это время аспиранты и сотрудники приняли участие в выполнении: 25 грантов, 2 целевых грантов, 2 научных программ и 2 совместных тем по линии РАН-СНРС. Лауреаты премии «За лучшую публикацию в журнале Молекулярная биология» за 2005 год и премий некоторых зарубежных университетов

4 Тесно сотрудничаем с кафедрой «математической логики и теории

Тесно сотрудничаем с кафедрой «математической логики и теории

алгоритмов» мех-мата МГУ, в частности, читаем там курс «Модели и алгоритмы в биоинформатике». Сотрудничаем с факультетом биоинформатики и биоинженерии МГУ, с факультетом ВМК. Регулярно ведем курсовые и дипломные работы, аспирантов. Сотрудничаем с аспирантурой Париж-7. Включая оплачиваемую работу.

5 Проблемы эффективности; 2) Модели и алгоритмы основных молекулярных

Проблемы эффективности; 2) Модели и алгоритмы основных молекулярных

процессов в клетке: геномы бактерий, растений, водорослей и простейших .....

ДНК=геном – последовательность в 4х-буквенном алфавите {A,C,T,G} с характерной длиной 3 миллиона – 6 миллиардов позиций. Каждая буква называется «нуклеотид».

6 Модели и алгоритмы (компьютерный счет)

Модели и алгоритмы (компьютерный счет)

Данные

Результат

7 Ген считывается по сигналу из лидерной области

Ген считывается по сигналу из лидерной области

Ген и сигнал эволюционируют!

Лидерная область 2

Лидерная область 3

Ген 1

Ген 2

Ген 3

Сигнал 2

Сигнал 3

инструкция для химической реакции – создается фермент; или для создания другой молекулы: белка или РНК

Инструкция для химической реакции 2

Инструкция для химической реакции 3

8 Один из возможных типов сигналов (= регуляций):

Один из возможных типов сигналов (= регуляций):

9 Даны n последовательностей

Даны n последовательностей

Задача: найти систему сай-тов (=сигнал,мотив) s = {s1,...,sk}, состоящую из сайтов s1,...,sk, где k ? n. Все сайты имеют одинаковую длину. Определяем качество системы как сумму попарных близостей сайтов, составляющих систему (=качество сигнала).

Leader region 1

Leader region n

10 Ищем систему сайтов с максимальным значением качества, т.е. ищем

Ищем систему сайтов с максимальным значением качества, т.е. ищем

минимум целевого функционала F в пространстве всех возможных систем:

11 Индуктивный шаг: от

Индуктивный шаг: от

1(•) и ?2(•) переходим к ?(•) по правилу: ? лучшая система ?1(?)+?2(?), полученная пере-бором всех ? и ? в *последователь-ностях

Идея нашего алгоритма. Делим все последовательности на две примерно равные части и лучшую систему в одной части объединяем с лучшей системой в другой части. Пусть ?1(?) – лучшая система в одной части как функция от ? (и фиксирована последовательность *), а ?2(?) – аналогичная система в другой части как функция от ? .

Lead. reg. 1

Lead. reg. n

12 Пример

Пример

Даны n=14 последовательностей, каждая с длиной m=201; ищем систему сайтов с длиной 15

13 Работа алгоритма:

Работа алгоритма:

14 Результат работы алгоритма:

Результат работы алгоритма:

15 Качество потенциального сигнала растет в процессе счета:

Качество потенциального сигнала растет в процессе счета:

Quality

Iteration

16 Последовательное изменение качества сигнала в ходе алгоритма:

Последовательное изменение качества сигнала в ходе алгоритма:

Quality

Iteration

17 Параллельная реализация вычислительно трудоемких алгоритмов: поиск

Параллельная реализация вычислительно трудоемких алгоритмов: поиск

мультибоксового регуляторного сигнала в группе геномов

Волновая вычислительная схема на двумерной ?-сети перестановок мощностью порядка n2 (в полном пространстве n! перестановок): отсутствует жёсткая привязка к числу процессоров кластера линейный рост производительности от числа доступных процессоров в широком диапазоне (проверено на МВС-1000М МСЦ, до 512 CPU)

«Однобоксовый» сигнал: - полный перебор O(mn) наш алгоритм O(n2m3) «Двухбоксовый» сигнал: - полный перебор O(mndn) наш алгоритм O(n2m3d3) (n – число последовательностей, m – максимальная длина, d – интервал расстояний между боксами сигнала)

Пример для n=45, m=201, 8 CPU

18 Wavelike computation scheme

Wavelike computation scheme

Using 2D queue of permutations (P,Q) instead of straight one

n=45, m=201, l=15, 8 CPU’s

P0(0) ? 175.8

P1(1) ? 206.0

P2(2) ? 201.6

260.6

P3(3) ? 260.6

P4(4) ? 211.7

P5(5) ? 198.8

P6(6) ? 197.6

P7(7) ? 207.7

P8(59) ? 218.7

P9(68) ? 184.2

P10(79) ?… 214.2

?Q0,0(11) 226.6

?Q1,0(12) 242.1

?Q2,0(14) 244.9

?Q3,0(13) 211.6

?Q4,0(8) 189.7

?Q5,0(10) 276.1

?Q6,0(9) 267.2

?Q7,0(15) 227.7

?Q8,0(66) 207.7

?Q9,0(75) 260.7

?Q0,1(18) 178.6

?Q1,1(19) 250.1

250.1

?Q2,1(22) 212.5

?Q3,1(21) 217.8

?Q4,1(17) 213.3

?Q5,1(16) 274.0

?Q6,1(20) 287.0

287.0

?Q7,1(23) 191.0

?Q8,1(76) 204.5

?Q0,2(26) 190.3

?Q1,2(27) 239.1

?Q2,2(31) 195.7

?Q3,2(28) 202.8

?Q4,2(25) 195.5

?Q5,2(24) 273.6

?Q6,2(30) 254.5

?Q7,2(29) 204.5

292.0

?Q0,6(58) 292.0

?Q1,6(60) 249.6

?Q2,6(63) 266.0

=====

?Q4,6(57) 196.2

?Q5,6(56) 287.9

?Q6,6(61) 275.1

?Q7,6(62) 190.0

?Q0,7(67) 274.0

=====

?Q2,7(70) 267.6

?Q4,7(65) 206.5

?Q5,7(64) 279.2

?Q6,7(71) 274.0

?Q7,7(69) 198.0

?Q0,8(74) 202.7

?Q2,8(78) 234.2

?Q4,8(73) 184.4

?Q5,8(72) 264.4

=====

?Q7,8(77) 193.0

19 Параллельная реализация вычислительно трудоемких алгоритмов:

Параллельная реализация вычислительно трудоемких алгоритмов:

реконструкция эволюции регуляторного сигнала в группе геномов

Усовершенствованная параллельная схема аннилинга MC3 (= Metropolis-Coupled Markov Chain Monte-Carlo): лучшее покрытие множества минимальных конфигураций меньшая зависимость от выбранной начальной точки более быстрая сходимость к одному из предполагаемых абсолютных минимумов функционала «энергии»

Индивидуальные режимы охлаждения

Периодический обмен параметрами охлаждения между находящимися в окрестности различных локальных или условных минимумов цепями с разной температурой способствует выходу из оврагов и локальных минимумов поверхности отклика.

20 x

x

y

Показана лидерная область перед геном, в ней «окно» с концами x и y, а в окне образуются «спирали»

Ген

Левое плечо

Правое плечо

21 «Спираль» с «плечами», склеиваются G с C и A с T:

«Спираль» с «плечами», склеиваются G с C и A с T:

22 Реальные еще очень простые вторичные структуры (=наборы спиралей):

Реальные еще очень простые вторичные структуры (=наборы спиралей):

23 T

T

A

Два состояния сигнала. Результат определяется тем, какая из двух альтернативных вторичных структур образуется: «Т» или «А»

Лидерная область

24 Результат одной нашей моделей регуляции:

Результат одной нашей моделей регуляции:

25 Примеры результатов счета в этой модели

Примеры результатов счета в этой модели

Мы считали функцию p=p(c) для практически всех лидерных областей аминокислотных оперонов и аминоацил-тРНК синтетаз. Имеется высокое согласие с экспериментом, с одной стороны, и предсказание многих новых случаев такой регуляции, с другой стороны. Здесь показаны thrA опероны у гамма-протеобактерий.

26 Два основных направления нашей работы в Биоинформатике:

Два основных направления нашей работы в Биоинформатике:

Модели и алгоритмы регуляции генов, Модели и алгоритмы эволюции этих регуляций (=сигналов)

27 Дано дерево G , у которого длины ребер соответ-ствуют времени переходу

Дано дерево G , у которого длины ребер соответ-ствуют времени переходу

от предка к потомку. Даны современные последовательности

Ищем все предковые последовательности

28 Иногда ищется и само дерево : тогда даны только современные

Иногда ищется и само дерево : тогда даны только современные

последователь-ности. Эти заданные последовательности – организмы, виды, гены, белки, сигналы

29 ?Конфигурация

?Конфигурация

Классическая аттенюаторная регуляция биосинтеза треонина у гамма-протеобактерий

VC = Vibrio cholerae, VV = Vibrio vulnificus, VP = Vibrio parahaemolyticus, AB = Actinobacillus actinomycetemcomitans, HI = Haemophylus influenzae, PQ = Mannheimia haemolytica, VK = Pasterella multocida, YP = Yersinia pestis, EO = Erwinia carotovora, TY = Salmonella typhi , XCA = Xanthomonas campestris, EC = Escherichia coli, KP = Klebsiella pneumoniae, SON = Shewanella oneidensis

30 Наша модель эволюции сигнала:

Наша модель эволюции сигнала:

Такая функция минимизируется с помощью алгоритма аннилинга. На каждом его шаге текущая конфигурация заменяется на новую из определенного списка возможностей с вероятностью или остается прежней с вероятностью . Нами доказана сходимость к глобальному min при условии

31 ?'j

?'j

Показано одно ребро от некоторой конфигурации ?. На этом ребре за время tj происходят: замены букв со скоростями R, вставки букв и делеции букв.

Сначала выравниваем позиции у ?j и ?'j, при этом возникают пустые позиции. Длины участков с пустыми позициями обозначим ljm. Тогда:

?j

tj

Слагаемое H1(?) в функции H

J-е ребро

32 Показано одно ребро от конфигурации

Показано одно ребро от конфигурации

. На этом ребре произошел переход от вторичной структуры hj в ?j к вторичной структуре h'j в ?'j.

hj

Тогда:

?j

h'j

Слагаемое H2(?) в функции H

?'j

J-е ребро

33 Решение (фрагмент): эволюция предкового сигнала

Решение (фрагмент): эволюция предкового сигнала

34 Поиск и эволюция сигнала другого типа («промотора»): некоторой

Поиск и эволюция сигнала другого типа («промотора»): некоторой

комбинации слов с условиями на них и расстояния

Ttgaca ...17-18н... Tataat стр. Ген

35 На следующем слайде показан удивительно консервативный (=устойчивый

На следующем слайде показан удивительно консервативный (=устойчивый

при эволюции) прмотор (перед геном psbA в пластидах)

На слайде через один показан противопо-ложный случай: быстро эволюционирующий (меняющийся) промотор среди цветковых растений (перед геном ndhF в пластидах). Он имеет четыре варианта A, B, C, D, сменяю-щие друг друга. Сами эти промоторы найде-ны, но здесь не приведены.

36 TTGACATGGCT=ATATAAGTCATGTTATACT Arabidop

TTGACATGGCT=ATATAAGTCATGTTATACT Arabidop

TTGACACGGG=CATATAAGGCATGTTATACT...ASpinacia TTCACGATA==TATATAAGTCATACTATACT Cycas TTGACATACA=GATATGTCTCATATTATACT Cryptomer TTGACATTGAT=ACATGGATCATATTATACT Pinus TTGACTTTAAT=AAACCATTTCTGTTATACT Welwitsch TTGACACGGAT=AGGTTTTT=GTGATATGCT Adiantum TTGACATCAAT=AGATAAGTTGTGTTATACT Angiopter TTGACATATAT=GGAAAGATCATGTTATACT Psilotum TTGACACAAA=AAGAAAGATTGTGTAATATT Huperzia TTGACATAC=TAATGGGATATGTGTAATAAT Aneura TTGACATAA=TCATATGTTATGTGTAATACT Marchantia TTGACATAA=TAATACATTTTGTGTAATACT Physcomitr TTGACATTT=TTATACTTTACATACTATAAT Chara TTGACATTAGTTATACGT=TTGTGCAATACT Chaetospha TTGACAGCT=TAAGGTTAAT=ATGTAATAAT Staurastr TTGACAACAG=CATTAACTATCTGTAATAAT Zygnema TTGACAAATA=AACATCATTT=TGGCATAAT Mesostig TTGATTAATATAA=ATTAATTA=GTTATAAT Bigelowiel

37 Институт проблем передачи информации РАН (http://www
38 Пример интересной темы для исследования – связь (РЕР) промоторов и

Пример интересной темы для исследования – связь (РЕР) промоторов и

предпочитаемых ими сигма-субъединиц. Например, нами показано, что промотор С предпочтительно связывает Sig4-субъединицу РНК-полимеразы. Аналогично для фаговых промоторов и полимераз.

39 Переходы, возможные в нашей модели регуляции, которая связана со

Переходы, возможные в нашей модели регуляции, которая связана со

спиралями:

(1) Правый конец y окна сдвигается на один нуклеотид вправо или остается на месте или подается сигнал «Т». Альтернатива: когда правый конец y доходит до начала гена, то подается сигнал «А». При этом вторичная структура в окне формирует выбор между Т или А; (2) Левый конец x окна сдвигается на три нуклеотида вправо или остается на месте, что зависит от частоты c предшествующего считывания регулируемого гена; (3) Вторичная структура преобразуется в окне, т.e. текущая вторичная структура ? трансформируется в новую структуру ?'.

40 В модели с предыдущего слайда ищется (выход алгоритма) зависимость

В модели с предыдущего слайда ищется (выход алгоритма) зависимость

p(c) – частота наступления состояния «Т» (несчитывания гена), при каждом фиксированном значении частоты считывания («концентрации») c. При наличии такой регуляции график p(c) имеет вид, показанный на слайдах 24 и 25. При ее отсутствии график p(c) имеет вид почти постоянной функции или даже убывающей функции.

41 Что можно читать по этим темам:

Что можно читать по этим темам:

1а) тип сигнала – «вторичная структура»: [Lyubetsky, Pirogov, Rubanov, Seliverstov, 2007, Journal of Bioinformatics and Computational Biology, vol 5, no 1, p. 155-180], 1b) тип сигнала – «промотор»: [Селиверстов, Лысенко, Любецкий, 2009, Физиология растений РАН, том 56, № 5; Seliverstov, Lyubetsky Молекулярная биология, представлена] 2) Модели эволюции этих регуляций, т.е. эволюции сигналов 1а и 1b: [Любецкий, Жижина, Рубанов, 2008, Гиббсовский подход в задаче эволюции регуляторного сигнала экспрессии гена, ППИ, №4; Горбунов, Любецкий МолБио, представлена] Статьи можно получить от авторов по адресу: gorbunov@iitp.ru

42 Наши биологические результаты (дает некоторый обзор, для слушателей не

Наши биологические результаты (дает некоторый обзор, для слушателей не

обязателен)

1. Проведена реконструкция эволюционных событий молекулярного уровня: построены деревья белков и согласующие их деревья видов, найдены события потенциальных горизонтальных переносов, потерь и дупликаций генов, случаи массовой дупликации генов в предковом геноме, статистические характеристики эволюционных событий по вершинам дерева видов и по таксономическим группам, сравнивались сценарии горизонтальных переносов против дупликаций и потерь генов. [In the book: Bioinformatics of Genome Regulation and Structure II. Springer Science & Business Media, Inc. 2005]

43 2. Предложены новые типы регуляции экспрессии генов: 2.1 Регуляция на

2. Предложены новые типы регуляции экспрессии генов: 2.1 Регуляция на

уровне трансляции, опосредован-ная Т-боксом, например, гена ileS, кодирующего изолейцил-тРНК синтетазу, у Актинобактерий. [BMC Microbiology, 2005, 5:54; Молекулярная биология, 2005, 39(6)] 2.2 Регуляция на уровне трансляции посредством взаимодействия рибосомы, транслирующей лидерный пептид, и вторичной структуры РНК для гена leuA, кодирующего 2-изопропилмалатсинтазу, у Актинобактерий («LEU-элемент»). [BMC Microbiology, 2005, 5:54; Молекулярная биология, 2005, 39(6)]

44 2.3 Сложные типы классической аттенюаторной регуляции (когда

2.3 Сложные типы классической аттенюаторной регуляции (когда

антитерминатор не альтернативен терминатору), например, у лактобацилл перед геном ilvD: это – цепь спиралей или псевдоузел. [готовится к печати] 2.4 Аттенюаторная регуляция генов cysK синтеза цистеина у Актинобактерий, вовлекающая ро-белок для терминации транскрипции: рибосома, транслирующая лидерный пептид, перекрывает сайт связывания ро-белка. [BMC Microbiology, 2005, 5:54] 2.5 Регуляция гена leuA у альфа-протеобактерий, вовлекающая ген лидерного пептида и консервативный псевдоузел («LEU1-регуляция»). [готовится к печати]

45 2.6 Регуляция, опосредованная аномально длинной спиралью РНК, генов,

2.6 Регуляция, опосредованная аномально длинной спиралью РНК, генов,

кодирующих транспортёры двухвалентных катионов (mntH) и ферменты, зависимые от металлов (никель-зависимая глиоксалаза и др.), у бруцелл. Выясняется роль этой регуляции в выживании бруцеллы при незавершённом фагоцитозе (бруцеллез). [Биофизика, в печати] 2.7 Статистические данные о расположении длинных спиралей в геномах Актинобактерий относительно кодирующих областей: длинные спирали концентрируются в некодирующих областях вблизи 3'-концов высоко экспрессируемых генов (включая тРНК) или между сходящимися навстречу друг другу генами. Выясняется роль таких шпилек в снятии конформационного напряжения ДНК и при терминации транскрипции путем образования крест-шпилек на ДНК. [МолБиол, 2007, 41(4)]

46 3. Найдены новые случаи известных типов регуляции у бактерий:

3. Найдены новые случаи известных типов регуляции у бактерий:

3.1 Предсказана белок-ДНКовая регуляция на уровне транскрипции и также промоторы генов синтеза пролина у протеобактерий родов Pseudomonas и Shewanella. [Молекулярная биология, 2007, 41(3)] 3.2 Предсказано много случаев белок-ДНКовой репрессии/активации. В частности, охарактеризован GlpR-регулон (регуляция метаболизма глицерол-3-фосфата). [Молекулярная биология, 2003, 37(5) – совместно с М.С. и его сотрудниками].

47 3.3 Проведен широкомасштабный поиск регуляции на уровне транскрипции

3.3 Проведен широкомасштабный поиск регуляции на уровне транскрипции

посредством Т-боксов. [Молекулярная биология, 2005, 39(6)] 3.4 Предсказана классическая аттенюаторная регуляция: (a) у протеобактерий (включая дельта-протеобактерии) и у видов из таксономических групп бацилл/клостридий и бактероидов [FEMS 2004], (b) у Актинобактерий [BMC Microbiology, 2005, 5:54]

48 3.5 Предсказана регуляция на уровне трансляции посредством тиаминового

3.5 Предсказана регуляция на уровне трансляции посредством тиаминового

рибопереключателя для гена ykoE, кодирующего субъединицу ABC транспортёра: происходит перекрывание сайта связывания рибосомы иногда прямо черенком рибопереключателя, а иногда дополнительной спиралью РНК – происходит быстрая смена этих механизмов регуляции у очень близких видов (показана эволюция этого механизма). [Информационные процессы, 2006, 6 (1)]

49 4. Белок-РНКовая регуляция в пластидах:

4. Белок-РНКовая регуляция в пластидах:

4.1 Корреляция сплайсинга с белок-РНКовой регуляцией трансляции в хлоропластах растений и водорослей. [Journal of Bioinformatics and Computational Biology, 2006, 4, 4, 783; Биофизика, 2006, 51, тематический выпуск 1] 4.2 Связь вторичной структуры РНК с редактированием инициирующего кодона в хлоропластах у мхов и папоротников. [Биофизика, 2006, 51, тематический выпуск 1] 4.3 Найдена высоко консервативная регуляция экспрессии генов psaA, psbA и psbB (вне связи со сплайсингом) [Journal of Bioinformatics and Computational Biology, 2006, 4(4)].

50 4.4 Найдена ортологичная консервативная регуляция гена ycf24 на уровне

4.4 Найдена ортологичная консервативная регуляция гена ycf24 на уровне

трансляции в пластидах красных водорослей и паразитов из таксона Apicomplexa (Eimeria tenella, Plasmodium spp., Toxoplasma gondii). Более того, у T. gondii эта регуляция охватывает и много других генов, включая те, которые кодируют РНК-полимеразу: этот ген кодирует белок SufB, необходимый для формирования железосероцентров. Выясняется роль пластид в жизни токсоплазм на молекулярном уровне. [Мол. биология, в печати]

51 5. Промоторы бактериального типа в пластидах и соответствующие им

5. Промоторы бактериального типа в пластидах и соответствующие им

сигма-факторы у растений и водорослей:

5.1 Изучена быстрая эволюция промоторов перед геном ndhF, чья транскрипция у Резушки Таля (Arabidopsis thaliana) существенно зависит от сигма-субъединицы Sig4. [Физиология растений, в печати]. 5.2 Предсказано, что кодируемая в ядре сигма-субъединица Sig4 РНК-полимеразы бактериального типа существовала уже у предка высших двудольных растений и у него же имелся Sig4-зависимый промотор: соответствующие кДНК sig4 найдены по базе EST у винограда Vitis vinifera и двух видов апельсина Citrus clementina и C. sinensis (у апельсинов это псевдоген). Также известен псевдоген sig4 у тополя Populus trichocarpa. А Sig4-зависимые промоторы предсказаны в хлоропластах у всех видов из таксона Eurosids II (включая крестоцветные, апельсин и хлопок), а также у нескольких далёких представителей двудольных: эвкалипта, винограда и платана.

52 5.3 Исследованы Sig3-зависимые промоторы перед геном psbN у семенных

5.3 Исследованы Sig3-зависимые промоторы перед геном psbN у семенных

растений и показано общее! для всех однодольных растений значительное отличие области этого промотора от прочих цветковых растений.

53 5.4 Найдены высоко консервативные хлоропластные промоторы

5.4 Найдены высоко консервативные хлоропластные промоторы

бактериального типа перед генами rbcL, psaA, psbA, psbB, psbE у большинства видов из Streptophyta. Более того, промотор перед геном psbA, кодирующим белок D1 второй фотосистемы, одинаков у Streptophyta, включая рано отделившиеся роды Mesostigma и Chlorocybus, и у вторичного симбионта Bigelowiella natans из таксона Cercozoa.

54 5.5 Найдены промоторы перед геном rps20 и близлежащие сайты связывания

5.5 Найдены промоторы перед геном rps20 и близлежащие сайты связывания

транскрипционного фактора (– ортолога NtcA) в хлоропластах красных и криптофитовых водорослей. При этом сайт для NtcA найден тогда и только тогда, когда дивиргентно располагается ген glnB. У цианобактерий оба белка NtcA и GlnB вовлечены в регуляцию генов метаболизма азота и их взаимная регуляция показана (в частности, NtcA активирует транскрипцию glnB). На этом основании предсказана регуляция в хлоропластах по механизму конкуренции РНК-полимераз, транскрибирующих гены на противоположных цепях ДНК, причем также происходит активация транскрипции glnB.

55 6. Найдена общая белок-ДНКовая регуляция экспрессии ядерных генов,

6. Найдена общая белок-ДНКовая регуляция экспрессии ядерных генов,

кодирующих рубредоксин и киназу, фосфорилирующую белки по тирозину, у диатомовой водоросли Thalassiosira pseudonana и у паразитов родов Theileria и Babesia

56 Эти виды являются вторичными симбионтами и имеют пластиды с общим

Эти виды являются вторичными симбионтами и имеют пластиды с общим

происхождением от красных водорослей. Однако их ядерные геномы сильно отличаются. Поэтому можно предполагать связь этой регуляции с пластидами. Интересно, что киназы обычно участвуют в регуляторных каскадах, передающих сигнал от некоторой мембраны, в частности, от пластиды. Пластиды у диатомовых водорослей и паразитов Apicomplexa похожи, а ядерные геномы значительно различаются. С другой стороны, у криптофитовых водорослей рубредоксин кодируется в нуклеоморфе, т.е. непосредственно связан с пластидами. Поэтому можно предположить, что эти очень близкие регуляторные механизмы связаны с появлением пластид.

«Институт проблем передачи информации РАН»
http://900igr.net/prezentacija/informatika/institut-problem-peredachi-informatsii-ran-180069.html
cсылка на страницу
Урок

Информатика

130 тем
Слайды
900igr.net > Презентации по информатике > Передача информации > Институт проблем передачи информации РАН